MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.

Slides:



Advertisements
Similar presentations
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Advertisements

Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
Genes and Chromosomes. DNA: The Molecule of Heredity Scientists have found that the substance Deoxyribosenucleic Acid (DNA), contained in chromosomes,
Genes and mutations. What are genes? A molecular unit of heredity The name for stretches of DNA and RNA that code for a specific protein (which has a.
Section DNA: The Molecule of Heredity
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.
Chapter 11 DNA Within the structure of DNA is the information for life- the complete instructions for manufacturing all the proteins for an organism. DNA.
Chapter 8 DNA and GENES Biology Notes.
MUTATIONS Section 11.3 pgs
Section 11.3 MUTATIONS Section 11.3 pgs
Mutations Chapter 12.4.
Genetic Changes 11.3.
Genetic Changes Chapter 11.3
Mutations Genetic Changes.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Ch Mutations Section Objectives:
Protein Synthesis Reading the DNA molecule to make proteins.
Mutations. What Are Mutations?  A change in the structure or amount of an organisms genetic material  This mutation can be a tiny change in DNA structure.
Review: DNA, Transcription & Translation
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?
Section 11.3 Genetic Changes.
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
  Understand what mutations are  Understand how they occur  Analyze the different types of mutations  Understand how mutations affect amino acid.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.
Mutations that happen during Transcription and Translation
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Chromosomes and Genes Each chromosome has hundreds or thousands of genes. Each gene codes for a particular protein.
Biology Ch. 11 DNA and Genes DNA  DNA controls the production of proteins Living tissue is made up of protein, so DNA determines an organism’s.
Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.
Section 11.3 MUTATIONS Section 11.3 pgs
From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
Mutation Notes: Chapter 11.
Section 11.3: Genetic Changes
Mutations.
Mutations 6/26/2018 SB2d.
Ch Mutations Section Objectives:
Mutations.
11.3 Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mermaid Syndrome Video.
Mutations.
What happens when things go wrong?
Gene Mutations.
Mutations.
Genetic Mutations.
Mutations.
Mutations.
Mutations LN #23 Ms. Garcia California Content Standard Genetics
To be successful today…
11.3 Section Objectives – page 296
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Mutations A mutation is any change in the DNA sequence.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations A mutation is any change in the DNA sequence.
Draw a conclusion from this graph for both the red and blue line
11.3 Section Objectives – page 296
Mutations.
Mutations.
Presentation transcript:

MONSTROUS MUTATIONS!!!

What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes of organisms!

Mutations in reproductive cells… If a mutation happened during the creation of the reproductive cells… –There could be non-functioning cells –New traits might be produced –Proteins may not work correctly –Embryo may not survive  There can be positive effects though! –Faster or stronger cells!

Mutations in body cells… If mutation is caused by radiation and it is a non-reproductive cell, the mutation may not be passed on to the offspring. However, the mutation could cause problems for the individual. Damage to the gene could impair the function of the cell. –Muscle cell may lose its ability to make the protein necessary for contraction –Skin cell may lose its elasticity.

Mutations in body cells… When the cells divide, the new cells will have the same mutation! Aging may be caused by a buildup of these mutated cells! Cancer is also caused by a mutation in the cell’s rate of division.

Point Mutations A point mutation changes a single base pair in the DNA sequence. What could this cause? –Change in amino acid sequence –EX: THE DOG BIT THE CAT. THE DOG BIT THE CAR. This is a BIG difference! In general, point mutations are less harmful than other mutations because it only changes one base in the sequence.

Frameshift Mutations A frameshift mutation occurs when a single base is added or deleted from the DNA sequence. This is a problem because it shifts the reading of codons by one base and thus a totally different protein is produced!

Chromosomal Mutations Chromosomal mutations are changes at the chromosomal level. Some of these changes may be caused by: –Chromosome parts breaking off –Lost parts of chromosomes –Parts that rejoin incorrectly –Parts that rejoin backwards or even the wrong chromosome part

Effects of Chromosomal Mutations: Occurs most often in plants! Few chromosomal mutations are passed on to the next generation because the zygote usually dies. If the zygote lives and grows up, usually it is sterile and cannot produce offspring or pass on the mutated genes.

Causes of Mutations Some mutations just happen! Similar to a silly mistake on a math problem. These are called SPONTANEOUS mutations! Many mutations are caused by environmental factors, such as, radiation. MUTAGENS are agents that can cause errors in DNA. –EX: high energy radiation, chemicals, high temperatures.