Michael Schroeder BioTechnological Center TU Dresden Biotec Discrete Algorithms for Computational Biology Gene Myers, MPI-CBG Michael Schroeder, Biotec,

Slides:

Advertisements

Similar presentations

1 Applications of Dynamic Programming zTo sequence analysis Shotgun sequence assembly Multiple alignments Dispersed & tandem repeats Bird song alignments.

Advertisements

數據分析 David Shiuan Department of Life Science Institute of Biotechnology Interdisciplinary Program of Bioinformatics National Dong Hwa University.

Introduction BNFO 602 Usman Roshan. Course grade Project: –Find a bioinformatics topic by Feb 5th. This can be a paper or a research question you wish.

BIOINFORMATICS Ency Lee.

1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a.

Bioinformatics “half a year in the lab can easily save you an afternoon in front of the computer….” (unknown)

. Class 1: Introduction. The Tree of Life Source: Alberts et al.

Non-coding RNA William Liu CS374: Algorithms in Biology November 23, 2004.

Educational Outreach in the Vision lab. What is “educational outreach”? Educational outreach......supports formal or classroom-based education...supports.

Profile-profile alignment using hidden Markov models Wing Wong.

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.

Bioinformatics and Phylogenetic Analysis

Introduction to Computational Biology Topics. Molecular Data Definition of data  DNA/RNA  Protein  Expression Basics of programming in Matlab  Vectors.

. Class 5: HMMs and Profile HMMs. Review of HMM u Hidden Markov Models l Probabilistic models of sequences u Consist of two parts: l Hidden states These.

Bio 465 Summary. Overview Conserved DNA Conserved DNA Drug Targets, TreeSAAP Drug Targets, TreeSAAP Next Generation Sequencing Next Generation Sequencing.

Comparative ab initio prediction of gene structures using pair HMMs

Michael Schroeder BioTechnological Center TU Dresden Biotec Algorithmic Bioinformatics.

Computational Genomics Lecture 1, Tuesday April 1, 2003.

Ayesha Masrur Khan Spring Course Outline Introduction to Bioinformatics Definition of Bioinformatics and Related Fields Earliest Bioinformatics.

ExPASy - Expert Protein Analysis System The bioinformatics resource portal and other resources An Overview.

Presented by Liu Qi An introduction to Bioinformatics Algorithms Qi Liu

Novel computational methods for large scale genome comparison PhD Director: Dr. Xavier Messeguer Departament de Llenguatges i Sistemes Informàtics Universitat.

Michael Schroeder BioTechnological Center TU Dresden Biotec Bioinformatics I.

Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.

9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.

Bioinformatics Timothy Ketcham Union College Gradutate Seminar 2003 Bioinformatics.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Protein Sequence Alignment and Database Searching.

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Sequence analysis: Macromolecular motif recognition Sylvia Nagl.

Basic Overview of Bioinformatics Tools and Biocomputing Applications I Dr Tan Tin Wee Director Bioinformatics Centre.

Next Semester Classes Planning. Previous bioinformatics class  They can give you an idea about the difficulty level and interestingness factor.

CS397-CXZ Algorithms in Bioinformatics ChengXiang (“Cheng”) Zhai, Robert Skeel (Department of Computer Science) Nick Sahinidis (Department of Chemical.

Intelligent systems in bioinformatics Introduction to the course.

Module 3 Sequence and Protein Analysis (Using web-based tools) Working with Pathogen Genomes - Uruguay 2008.

CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.

Multiple Sequence Alignments Craig A. Struble, Ph.D. Department of Mathematics, Statistics, and Computer Science Marquette University.

Introduction to Bioinformatics Biostatistics & Medical Informatics 576 Computer Sciences 576 Fall 2008 Colin Dewey Dept. of Biostatistics & Medical Informatics.

CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Multiple Alignment and Phylogenetic Trees Csc 487/687 Computing for Bioinformatics.

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.

Comp. Genomics Recitation 9 11/3/06 Gene finding using HMMs & Conservation.

Central dogma: the story of life RNA DNA Protein.

EB3233 Bioinformatics Introduction to Bioinformatics.

Algorithms for Biological Sequence Analysis Kun-Mao Chao ( 趙坤茂 ) Department of Computer Science and Information Engineering National Taiwan University,

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

Basic Overview of Bioinformatics Tools and Biocomputing Applications II Dr Tan Tin Wee Director Bioinformatics Centre.

Sequence Based Analysis Tutorial March 26, 2004 NIH Proteomics Workshop Lai-Su L. Yeh, Ph.D. Protein Science Team Lead Protein Information Resource at.

March 28, 2002 NIH Proteomics Workshop Bethesda, MD Lai-Su Yeh, Ph.D. Protein Scientist, National Biomedical Research Foundation Demo: Protein Information.

An Introduction to NCBI & BLAST National Center for Biotechnology Information Richard Johnston Pasadena City College.

V diagonal lines give equivalent residues ILS TRIVHVNSILPSTN V I L S T R I V I L P E F S T Sequence A Sequence B Dot Plots, Path Matrices, Score Matrices.

V diagonal lines give equivalent residues ILS TRIVHVNSILPSTN V I L S T R I V I L P E F S T Sequence A Sequence B Dot Plots, Path Matrices, Score Matrices.

Michael Schroeder BioTechnological Center TU Dresden Biotec Semantic Search: Algorithms and Applications.

DNA Sequences Analysis Hasan Alshahrani CS6800 Statistical Background : HMMs. What is DNA Sequence. How to get DNA Sequence. DNA Sequence formats. Analysis.

4.2 - Algorithms Sébastien Lemieux Elitra Canada Ltd.

Multiple Sequence Alignment Dr. Urmila Kulkarni-Kale Bioinformatics Centre University of Pune

BME435 BIOINFORMATICS.

bacteria and eukaryotes

Bioinformatics Overview

Hidden Markov Models (HMM)

Bioinformatics Madina Bazarova. What is Bioinformatics? Bioinformatics is marriage between biology and computer. It is the use of computers for the acquisition,

생물정보학 Bioinformatics.

Algorithms for Biological Sequence Analysis

Multiple Sequence Alignment

Bioinformatics Biological Data Computer Calculations +

Bioinformatics: Buzzword or Discipline (???)

CISC 667 Intro to Bioinformatics (Spring 2007) Review session for Mid-Term CISC667, S07, Lec14, Liao.

Presentation transcript:

Michael Schroeder BioTechnological Center TU Dresden Biotec Discrete Algorithms for Computational Biology Gene Myers, MPI-CBG Michael Schroeder, Biotec, TUD Dresden Michael Hiller, MPI-CBG

By Michael Schroeder, Biotec2 Bioinformatics BIOlogy matheMATICS INFORmatics

By Michael Schroeder, Biotec3 Bioinformatics Bioinformatics = Biological + Informatics

By Michael Schroeder, Biotec4 Bioinformatics Bioinformatics = Biological + Informatics - Logical

Synopsis nComputational problems and algorithmic solutions for genomic data nPre-requesite: Data structure and basic algorithms nGoal: n(a) able to design a dynamic programming n(b) understand sequence comparison and Hidden Markov Model methods n(c) understand, use, and programme sequence-based bioinformatics By Michael Schroeder, Biotec5

Part 1: Sequence comparison nWeek 1: Primer on Molecular Biology nWeek 2-5: Sequence Comparison, theory and practice nThe basic dynamic programming algorithm, gap cost variations, extension to patterns. nAcceleration: indexing, filtration methods, FASTA and BLAST as examples. nMulti-sequence alignment: scoring schemes, greedy/DCA/MSA/round-robin heuristics. By Michael Schroeder, Biotec6

Part 2: Gene Finding nWeek 6-9: Gene Finding nApproaches: statistical, homology-based, Bayesian via Hidden Markov Models. nHidden Markov Models (HMMs): Viterbi and forward/backward algorithms By Michael Schroeder, Biotec7

Part 3: Phylogeny nWeek 10-13: Phylogeny nJukes-Cantor model, maximum-likelihood method, distance-based methods, neighbor-joining, HMMs. Genome rearrangements By Michael Schroeder, Biotec8

Part 4: Optional topics nWeek 14: Optional Topics (per instructor and time permitting) nRNA Secondary Structure: Definitions, Scoring schemes, dynamic programming approaches. nMotif Finding: Repeat finding. Promoter and enhancer recognition. Signal peptide recognition. nGenotyping: Basic genetics, haplotype determination, haplotype blocks, forensic identification. nGenome Sequence Assembly: Technology overview. Overlap-layout-consensus paradigm. Approaches. By Michael Schroeder, Biotec9

By Michael Schroeder, Biotec10 Getting in touch Web site:

By Michael Schroeder, Biotec11 Useful books