Ethics of Genetic Engineering Technological Advance Could We? Should We? National DNA registry Prenatal phenotype diagnosis Prenatal disorder correction.

Slides:



Advertisements
Similar presentations
DNA Technology & Genomics
Advertisements

Biotechnology Read textbook sections 20.1 & 20.2 on your own Draw 10 boxes to complete the following notes Turn into the purple box when you are done.
& Gel Plasmid Electrophoresis Mapping.
DNA Technology and Genomics
Biotechnology Packet #26 Chapter #9. Introduction Since the 1970’s, humans have been attempted to manipulate and modify genes in a way that was somewhat.
Manipulating DNA Genetic Engineering uses the understanding of the properties of DNA to study and change DNA sequences in living organisms – Invitro… in.
Chapter 20~ DNA Technology & Genomics
DNA Technology n Now it gets real….. O.J. Simpson capital murder case,1/95-9/95 Odds of blood on socks in bedroom not being N. Brown-Simpson’s: 8.5 billion.
Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:
Chapter 20 DNA Technology and Genomics
AP Biology Ch. 20 Biotechnology.
Chapter 20 DNA Technology. DNA Cloning  Gene cloning allows scientists to work with small sections of DNA (single genes) in isolation. –Exactly what.
Biotechnology. Southern Blot/Electrophoresis Electrophoresis- separate DNA with electricity Step 1: DNA is isolated and cut with restriction enzymes –Makes.
Technological Solutions. In 1977 Sanger et al. were able to work out the complete nucleotide sequence in a virus – (Phage 0X174) This breakthrough allowed.
Manipulating DNA.
1 DNA Technology. 2 Copying DNA: PCR Polymerase Chain ReactionPolymerase Chain Reaction Gene Amplification A method of making many copies of a piece of.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Genetic Engineering. What is genetic engineering? Application of molecular genetics for practical purposes Used to – identify genes for specific traits.
Class Notes 1: DNA Manipulation. I. DNA manipulation A. During recent years, scientists have developed a technique to manipulate DNA, enabling them to.
NIS - BIOLOGY Lecture 57 – Lecture 58 DNA Technology Ozgur Unal 1.
Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.
DNA Technology. Overview DNA technology makes it possible to clone genes for basic research and commercial applications DNA technology is a powerful set.
Genetics 6: Techniques for Producing and Analyzing DNA.
L AB 6: M OLECULAR B IOLOGY L AB 6: M OLECULAR B IOLOGY Description Transformation insert foreign gene in bacteria by using engineered plasmid.
DNA Technology Chapter 11. Genetic Technology- Terms to Know Genetic engineering- Genetic engineering- Recombinant DNA- DNA made from 2 or more organisms.
Chapter 20 DNA Technology and Genomics. Viruses have restriction enzymes to attack and destroy invading viral DNA. Restriction enzymes cut DNA at specific.
Desired Gene Restriction Enzymes Bacterial defense against viral DNA Bacterial defense against viral DNA Cut DNA at specific sequences Cut DNA at specific.
Biology 1060 Chapter 20 DNA Technology and Genomics.
INTRODUCING…. THE APPLORANGE Finally and orange with an edible peel.
Biotechnology 1. Analysis of Clonal DNA 2. DNA Cloning 3. Stem Cells 4. Practical Applications of DNA Technology.
Biotech. Cloning a mammal PCR This is the polymerase chain reaction. It is a technique to multiply a sample of DNA many times in a short period of time.
Biology Chapter 9 & Honors Biology Chapter 13 Frontiers Of Biotechnology.
DNA Technology and Genomics
DNA Technology Ch. 20. The Human Genome The human genome has over 3 billion base pairs 97% does not code for proteins Called “Junk DNA” or “Noncoding.
Chapter 20 DNA Technology and Genomics. Biotechnology is the manipulation of organisms or their components to make useful products. Recombinant DNA is.
Human Genome Project - established to determine DNA sequence of humans. - useful in locating genes and curing disorders. Example Gene Therapy- replacing.
Vocab review Unit 8 - biotechnology. 1. Organism that has acquired genetic material by artificial means.
RECOMBINANT DNA DNA THAT CONTAINS DNA SEGMENTS OR GENES FROM DIFFERENT SOURCES. DNA TRANSFERRED FROM ONE PART OF A DNA MOLECULE TO ANOTHER, FROM ONE CHROMOSOME.
The genetic engineers toolkit A brief overview of some of the techniques commonly used.
Difficulties with DNA 1. 1.One cell normally provides too little material for study Gene cloning Polymerase Chain Reaction (PCR) 2. 2.There are often.
Aim: How do scientists identify people using DNA Fingerprinting?
Aim: What are some techniques used in DNA engineering?
Studying and Manipulating Genomes
Jeopardy Final Jeopardy Gene Cloning Plasmids Ligase PCR $100 $100
Aim: How do scientists identify people using DNA Fingerprinting?
Recombinant DNA Technology
DNA Technology Packet #27.
Chapter 13.2 Manipulating DNA.
Additional DNA Technology AP Biology Ms. Day
Restriction Enzymes and Plasmid Mapping
DNA Tools & Biotechnology
DNA Technology Now it gets real…..
DNA Technology & Genomics
DNA Technology.
Chapter 20 – DNA Technology and Genomics
5. Genetic Engineering Techniques
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
DNA Technology.
The student is expected to: (6H) describe how techniques such as DNA fingerprinting, genetic modifications, and chromosomal analysis are used to study.
Biotechnology Ch 13.4, 15.4,
DNA Tools & Biotechnology
DNA TECHNOLOGY.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Chapter 7 DNA Fingerprinting.
Genetics and Biotechnology
Genetics and Biotechnology
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Lecture #9 Date _____ Chapter 20~ DNA Technology & Genomics.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Presentation transcript:

Ethics of Genetic Engineering Technological Advance Could We? Should We? National DNA registry Prenatal phenotype diagnosis Prenatal disorder correction Non-medical enhancement Transgenic crops Transgenic humans Rate from 1 (no) to 5 (yes) for these potential advances Describe one pro and one con for each advance.

Transgenic Organisms

Difficulties with DNA 1. 1.There are often thousands of genes on a DNA molecule Electrophoresis 2. 2.One cell normally provides too little material for study Polymerase Chain Reaction (PCR) Gene cloning

Restriction Enzymes Bacterial defense against viral DNABacterial defense against viral DNA Excise DNA at specific sequencesExcise DNA at specific sequences CCTTTG AATTCCCAGAATC GGAAACTTAA GGGTCTTAG AATTCGGCCATATACG GCCGGTATATGCTTAA Desired Gene Target Sites for EcoRI

Electrophoresis Separation of molecules based on sizeSeparation of molecules based on size Negatively charged DNA molecules are pulled through a gel by an electrical fieldNegatively charged DNA molecules are pulled through a gel by an electrical field Smaller molecules travel faster and fartherSmaller molecules travel faster and farther

Restriction Fragment Length Polymorphisms (RFLP’s)AAGAATTCCCTGATCCATATATATATATCGGATCTAGAATTCTTCTTAAGGGACTAGGTATATATATATAGCCTAGATCTTAACAAGAATTCCCTGATCCATATATCGGATCTAGAATTCTTCTTAAGGGACTAGGTATATAGCCTAGATCTTAAC Variations in DNA Variations in fragment sizes Variations in electrophoresis bands

Cujo Jordan Poop

Restriction Mapping (kilobases) Uncut plasmid Cut with EcoRI Cut with BamH3 Cut with Both DNA Marker

Gene Cloning

Using Radioactive Probes Each well contains a sample An impression is made Radioactive probes applied Probe is complementary to desired gene Adhered probe leaves dot on radiosensitive film

Intron Elimination Intron Complementary DNA (cDNA) Eukaryotic mRNA

Polymerase Chain Reaction In vitro amplification of a select length of DNAIn vitro amplification of a select length of DNA Denaturation Priming Elongation Desired Gene

Organismal Cloning

Stem Cells