METHODS Effects of glucose alterations on MnSOD and CuZnSOD expression in human retinal pigmented epithelial cells Katie M. Hertz Mentor: Dr. Kaltreider Department of Biology, York College of Pennsylvania RESULTS CONCLUSIONS  This study concludes that SOD gene expression increased under different alterations of glucose. Inhat et al. (2007) showed that SOD protein levels and protein activity in ARPE cells were significantly lower in a 24-hr oscillating 5, 30mM treatment compared to continuous 5mM. Together these findings suggest that in diabetics with complications a defect in SOD may not exist at the gene level but at the protein level.  The 30mM (2 weeks) to 5mM (1 week) treatment group suggests cell memory; after week 3 MnSOD continued to increase 2.5 fold rather than drop back to baseline.  Results suggest that the breakdown of superoxide predominately occurs in the mitochodria by MnSOD; however, the spike in CuZnSOD expression after the week 3 of treatment suggests that some superoxide leaks into the cytoplasm. REFERENCES American Diabetes Association (ADA). Conditions and Treatments. Available from:. Accessed 2008 January 27. Baynes, J.W. and Thorpe, S.R Role of oxidative stress in diabetic complications: a new perspective on an old paradigm. Diabetes [serial online] 48: 1-9. Brownlee, M The pathobiology of diabetic complications: a unifying mechanism. Diabetes [serial online] 54: Ceriello, A., della Russo, P., Amstad, P., and Cerutti, P High glucose induces antioxidant enzymes in human endothelial cells in culture: evidence linking hyperglycemia and oxidative stress. Diabetes [serial online] 45: Hodgkinson, A.D., Bartlett, T., Oates, P.J., Millward, B.A., and Demaine, A.G The response of antioxidant genes to hyperglycemia is abnormal in patients with type 1 diabetes and diabetic nephropathy. Diabetes [serial online] 52: Ihnat, M., Kaltreider, R., Thorpe, J.E., Green, D., Kamat, C., Leeper, M., Shanner, A., Warnke, L., Piconi, L., and Ceriello, A Attenuated superoxide dismutase induction in retinal cells in response to intermittent high versus continuous glucose. American Journal of Biochemistry and Biotechnology 3(1): Pagaonkar, V.A., Leverenz, V.R., Dang, L., Chen, S.,Pelliccia, S. and Giblin, F.J Thioredoxin reductase may be essential for the normal growth of hyperbaric oxygen-treated human lens epithelial cells. Experimental Eye Research 79(6): 847–857. ACKNOWLEDGEMENTS I would especially like to thank my mentor Dr. Kaltreider for all of his time, insight, and guidance over the past few years as I worked on this project. I would also like to acknowledge the entire York College Biology Faculty for all of their support and the knowledge they bestowed upon me over the past four years. Isolate RNA RT 0.5µg RNA Electrophoresis 2% agarose gel 200V Gelstar Orange Densitometry Fluorochem Imager Based on Integrated Density Value Quantify RNA Cell Culture Week 1 Isolate RNA OBJECTIVE To determine the effects of alterations of glucose concentrations on MnSOD and CuZnSOD mRNA expression in human retinal pigment epithelial (RPE) cells mM 30 to 5mM5 to 30mM 30 to 5mM Cell Culture  ARPE-19 cells  Split 1:4 every 3-4 days in T25 flasks  Glucose Treatments Controls: −5mM −30mM Experimental: −5 to 30mM daily oscillation −5mM (2 weeks) to 30mM (1 week) −30mM (2 weeks) to 5mM (1 week) Cell Culture Week 3 Cell Culture Week 2 INTRODUCTION 20.8 million people in the U.S. have diabetes according to the American Diabetes Association (ADA). Diabetes is marked by hyperglycemia and oxidative stress (Baynes and Thorpe 1999), and many diabetics develop complications such as retinopathy, a leading cause of blindness in adults. Diabetes control and early detection are currently the best ways to prevent tissue damage (ADA) although the exact molecular mechanism leading to damage is still unknown.  Brownlee (2005) proposed a “unifying mechanism” whereby hyperglycemia causes an excess of reactive oxygen species (ROS), such as superoxide anion (O 2 - ), to be produced by the electron transport chain during cellular respiration.  Superoxide dismutase (SOD) is a key antioxidant enzyme that breaks down O 2 - into a less reactive species H 2 O 2. Glutathione peroxidase (GPx) and catalase (CAT) are other antioxidant enzymes that are involved in the process and help breakdown hydrogen peroxide into water but are not key regulators. SOD 2O H + → H 2 O 2 + O 2  Mitochondrial MnSOD and cytoplasmic CuZnSOD are two main forms of SOD. This is important because damage may be related to superoxide leakage from the mitochondria (Hodgkinson et al. 2003).  In vitro, Ceriello et al. (1996) found that continuous high glucose induced overexpression of antioxidant enzyme CuZnSOD in cells. In contrast, Hodgkinson et al. (2003) found evidence that mRNA expression of CuZnSOD decreases in diabetic patients with complications suggesting that there is a defect in the antioxidant enzyme.  Recently, SOD activity was shown to be significantly lower in retinal pericytes and ARPE-19 cells subjected to oscillating glucose than in those exposed to continuous high glucose (Ihnat et al. 2007). PCR 60°C annealing temperature 30 cycles 1μl cDNA Primers from Padgaonkar et al Figure 1. Gel images of MnSOD and CuZnSOD cDNA. Isolated mRNA was quantified, 0.5μg of each sample was reverse transcribed. 30 cycles of PCR amplified 1μl cDNA for each sample. 2% agarose gel was loaded with 20µl of each cDNA sample and electrophoresis was run for Week 1 MnSODCuZnSOD Week 2 Week mM 5, 30mM osc. RESULTS MnSOD  Over the progression of 3 weeks across all treatment groups, MnSOD expression increased.  30mM treatment showed over a 2-fold increase in MnSOD expression compared to 5mM week 1 treatment.  The oscillating treatment group shows similar trends as 30mM treatment.  Across all groups, alterations in MnSOD expression are not observed until week 3.  5 to 30mM and 30 to 5mM at week 1 both had extremely low levels of SOD expression.  CuZnSOD  The alteration trends of CuZnSOD expression were similar to the MnSOD expression over the 3 weeks, except the fold increase of CuZnSOD was not as dramatic. FUTURE STUDIES  Look at greater sample size and use a cDNA specific loading control to do statistics and determine if alterations in SOD expression are truly significant.  Determine if passage number of cells affects SOD expression by looking at treatment groups over a longer time period. GenePrimerTarget size MnSODUpstream: ggtagcaccagcactagcagc Downstream: gtacttctcctcggtgacgttc 228 CuZnSODUpstream: cactctcaggagaccattgc Downstream: ggcctcagactacatccaag 175 Week 1 Week 2 Week 3 5mM 30 to 5mM5 to 30mM 30 to 5mM 30mM 5, 30mM osc. Figure 2. A) Fold increase of MnSOD in human RPE cells in 5 different glucose treatments over 3 week period. B) Fold increase of CuZnSOD in human RPE cells in 5 different glucose treatments over 3 week period. RNA was isolated after each week of treatment followed by quantification, RT-PCR, and gel electrophoresis. Densities of bands on gel were averaged and divided by the average of Week 1 5mM (control) to obtain mean fold increase. Sample size was 2 except for Week 1 30mM and Week 1 5, 30mM oscillating; these had n=1 due to absence of band on gel. Each bar (and value above bar) represents the mean densitometry, and error bars represent SEM.