The analysis of homologous recombination frequency 1.There are two assays (artificial substrates) for double-strand break (DSB) induced homologous recombination.

Slides:



Advertisements
Similar presentations
How we can achieve disruption of the genes essential for cell viability in DT40 cells? Tackling essential genes; tagging Minoru Takata Laboratory of DNA.
Advertisements

Phenotypic consequences of specific mutations in human MLH1 Sierra Spencer Dr. Andrew Buermeyer Department of Environmental and Molecular Toxicology Oregon.
G-Fectin TM 1. A novel transfection reagent developed by Genolution 2.Cationic lipid based 3. no cell splitting is required 4. Whole transfection can be.
IOSI Journal Club Giulia Poretti June 1, RMCE targeted transgenesis system in a lymphoma cell line: a tool for studying the function of candidate.
Cloning GADD45a into pCMV-Myc1 or pCMV-nV-His6 Gadd45EcoVF ATCCATGACTTTGGAGGAATTCTCGGCTGGAGAGC Gadd45XbaR GTAATCTAGATCACCGTTCAGGGAGATTAATCACTGG Cloning.
Select transformants on LB plates containing 100 μg/ml ampicillin  Successful colonies K562: 27 colonies Hela: 11 colonies IM9: 25 colonies Lab Meeting.
Homology-directed gene repair Sequence correction xx exogenous repair substrate Rad51… sister chromatids I-SceI.
LECTURE 4. SCREENING cDNA LIBRARIES to ISOLATE NEW GENES: DIFFERENTIAL HYBRIDIZATION ORIGINAL ARTICLE: **Davis, RL, Weintraub, H, and Lassar, A
Transfection.
Targeted gene alteration in Caenorhabditis elegans by gene conversion Peter L Barrett, John T Fleming & Verena Göbel Nat Genet Oct 24.
Gene repair in murine hematopoietic stem cells (NGEC Component 6) Aim 1: Develop and test a murine X-linked severe combined immunodeficiency (XSCID) model.
Gene repair in murine hematopoietic stem cells (NGEC Component 6) Aim 1: Develop murine X-linked severe combined immunodeficiency (XSCID) models for I-SceI.
The chicken light chain locus: a model of homology-directed repair of SSBs? VV VJ C VJ C Chicken pre-B cell line DT4O: carries out constitutive templated.
The beginnings of gene editing
NGEC Applications Meeting Mike Certo Scharenberg Lab.
B Supplementary Fig S1. (A) ZR75- and MCF7-PELP1 knockdown cells were generated as described in methods section. Pooled colonies were analyzed for PELP1.
Faithfulness and Infidelity: Homologous Recombination and DNA Double-Strand Break Repair in Mammalian Cells.
GFP (%) GenJet Fugene L2K Amaxa Figure1. A comparison study showing exceptional efficiency of GenJet™ reagent on C2C12 cells. Application Note Explorer,
GFP (%) GenJet Fugene L2K Amaxa Figure1. A comparison study showing exceptional efficiency of GenJet™ reagent on HepG2 cells. Application Note Explorer,
Homology-directed gene repair
Nucleases for Genome Engineering Philippe Duchateau.
Altogen Biosystems offers the Transfection Reagent for PANC-1 Cells Transfection Reagent among a host of 100+ cell line specific In Vitro Transfection.
Products > B16-F10 Transfection Reagent (Mouse Melanoma Cells) Altogen Biosystems offers the B16-F10 Transfection Reagent among a host of 100+ cell line.
Products > PC-3 Transfection Reagent (Prostate Cancer Cells) Altogen Biosystems offers the PC-3 Transfection Reagent among a host of 100+ cell line specific.
Products > Transfection Reagent for C6 Cells (Glioma Cells, CCL-107) Altogen Biosystems offers the C6 Transfection Reagent among a host of 100+ cell line.
Products > 3T3-L1 Transfection Reagent (Embryonic Fibroblast Cells, CL-173) Altogen Biosystems offers the 3T3-L1 Transfection Reagent among a host of 100+
Products > HeLa-S3 Transfection Reagent (Cervical Adenocarcinoma) Altogen Biosystems offers the HeLa-S3 Transfection Reagent among a host of 100+ cell.
Transformation of Bacteria
Targeted Disruption of V600E-Mutant BRAF Gene by CRISPR-Cpf1
Products > CT26.WT Transfection Reagent (Colon Carcinoma)
Figure 1 tPA and TPO DI and control expression vectors
Protocol for Generation of Stable Cell LinesStable Cell Lines.
Yasuhiro Kazuki, Mitsuo Oshimura  Molecular Therapy 
Molecular Therapy - Nucleic Acids
The impact of the IGF-1 system of cancer cells on radiation response – An in vitro study  Senthiladipan Venkatachalam, Esther Mettler, Christian Fottner,
ASF1a Promotes Non-homologous End Joining Repair by Facilitating Phosphorylation of MDC1 by ATM at Double-Strand Breaks  Kyung Yong Lee, Jun-Sub Im, Etsuko.
Volume 9, Issue 1, Pages (January 2002)
Brca1 Controls Homology-Directed DNA Repair
Products > IRR-MRC5 Transfection Reagent (Irradiated Fibroblasts)
Volume 17, Issue 3, Pages (February 2005)
Products > IMR-90 Transfection Reagent (Lung IMR-90, CCL186)
Expression of SYCE2 activates the DSB repair pathway.
Molecular Therapy - Nucleic Acids
Volume 7, Issue 3, Pages (September 2016)
Volume 31, Issue 5, Pages (September 2008)
Volume 1, Issue 3, Pages (September 2013)
Altogen labs Leading Developer and Manufacturer of In Vivo and DNA Transfection Kits, Transfection Reagents and Electroporation Delivery Products Products.
Myc Requires Distinct E2F Activities to Induce S Phase and Apoptosis
BRCA2 Is Required for Homology-Directed Repair of Chromosomal Breaks
Molecular Therapy - Nucleic Acids
Andy K. W. Hsu, Beverley M. Kerr, Kathryn L. Jones, Richard B
Volume 10, Issue 2, Pages (February 2018)
Marie Frank-Vaillant, Stéphane Marcand  Molecular Cell 
Olivier Humbert, Nancy Maizels  Molecular Therapy - Nucleic Acids 
Volume 127, Issue 4, Pages (October 2004)
Catherine H. Wu, George Y. Wu  Gastroenterology 
Control of Sister Chromatid Recombination by Histone H2AX
Regulation of Expression of IL-4 Alleles
Volume 47, Issue 4, Pages (August 2012)
Volume 24, Issue 18, Pages (September 2014)
Effect of RK‐33 on radiation‐induced DNA damage AImmunofluorescence images showing 53BP1 and γH2AX foci in A549 cells after 2‐Gy radiation and A549 cells.
Transient expression of PU
Cre-loxP-mediated chromosomal engineering in mice.
Volume 2, Issue 6, Pages (June 2014)
Volume 5, Issue 5, Pages (November 2015)
(B) HDR assay (6nt) (D) HDR assay (1nt)
A. A. XPCKD and KIN17KD HeLa cells grow poorly 2 weeks after transfection. Forty-eight hours after transfection, cells were plated at the same density.
Volume 10, Issue 2, Pages (February 2018)
A. A. Comparison of transient HSAKIN17 gene silencing induced by either siRNA duplexes or EBV-based siRNA vectors. Twenty-four hours after seeding, HeLa.
Presentation transcript:

The analysis of homologous recombination frequency 1.There are two assays (artificial substrates) for double-strand break (DSB) induced homologous recombination (HR), SCneo and DR-GFP. Difference in the frequency of HR between wild-type and HR deficient clones tends to be larger in SCneo than in DR-GFP. 2.DT40 clones carrying SCneo or DR-GFP in the OVALBUMIN locus are stored in liquid N 2. 3.A HR assay using DR-GFP takes only two days, whilst A HR assay using SCneo takes more than a week (time for neo selection). 4.Data from the DR-GFP assay vary substantially in individual experiments. You should not use the cells that are incubated in 10 6 /ml density, because cells’ viability may be compromised. 5.You should use BioRad machine but not AMAXA for electoro-poration, because AMAXA gives only 50% increase in the efficiency of transient transfection whereas costs 10 folds, in comparison with BioRad. 6.You should note that electroporation condition is different between stable transfection (550V/ 25  F, BioRad) and transient transfection (250V/960  F, BioRad). 7.On the following pages, Dr. Sonoda described data of DR-GFP HR assay.

DR-GFP DSB repair substrate in OVA locus knock-in construct:Puro R (#18-922) transfection into DT40 cells Selection with puromycine Isolation of targeted clones (Wild-type; #2271) DR-GFP assay 1. By GenePulser 2. By Amaxa 5x10 6 cells in 0.5ml medium 20ug of I-SCEI Pulse with 250V/960uF + 1X10 6 cells in 100ul/Solution T 3-5ug of I-SCEI Pulse with A30 (or B23) Plate the cells into 15ml medium + %GFP positive cells Hours after transfection GFP positive cells reach maximum number at 36-48h after TF Count GFP positive cells by FACS Representative data

DR-GFP in OVA targeting vector (#18-922) made by Takenaka Cells with DR-GFP #2271: wild-type (puro R )

Amaxa; I-SCEI (#13-217) 3-5ug/SolutionT/A30 program %GFP positive cells Amaxa (I-SceI, 3ug/SolT/B23) Gene Pulser (I-SceI, 20ug/250V/975uF) done by Wang Cost Amaxa: 2000yen/TF GenePulser: 200yen/TF