Biology Chapter Review

Slides:



Advertisements
Similar presentations
Chapter 10 How proteins are made.
Advertisements

Chapter 17~ From Gene to Protein
Biology Ch. 12 Review.
Transcription and Translation Flip Book Your Name Your Class Period.
RNA and PROTEIN SYNTHESIS
RNA = RiboNucleic Acid Synthesis: to build
Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.
Molecular Genetics Protein Synthesis Gene Regulation Mutations Biotechnology.
RNA Ribonucleic Acid.
Express yourself That darn ribosome Mighty Mighty Proteins Mutants RNA to the Rescue
How Proteins are Made. I. Decoding the Information in DNA A. Gene – sequence of DNA nucleotides within section of a chromosome that contain instructions.
Protein Synthesis: The Central Dogma of Biology Chapter 8 in your textbook.
Ribonucleic Acid (RNA) & Protein Synthesis Ms. Napolitano & Mrs. Haas CP biology.
Chapter 17 Notes From Gene to Protein.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
From DNA to Protein Chapter DNA, RNA, and Gene Expression  What is genetic information and how does a cell use it?
RNA and Protein Synthesis
DNA, RNA, & Proteins Vocab review Chapter 12. Main enzyme involved in linking nucleotides into DNA molecules during replication DNA polymerase Another.
RNA and Protein Synthesis
RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.
Chapter 12 Gene Expression Unlocking the secrets of DNA.
Part Transcription 1 Transcription 2 Translation.
What is the job of p53? What does a cell need to build p53? Or any other protein?
From Gene to Protein Transcription – the synthesis of RNA from the DNA template –messenger RNA (mRNA) – carries a genetic message from the DNA in the.
Protein Synthesis: DNA CONTAINS THE GENETIC INFORMATION TO PRODUCE PROTEINS BUT MUST FIRST BE CONVERTED TO RND TO DO SO.
Chapter 13. The Central Dogma of Biology: RNA Structure: 1. It is a nucleic acid. 2. It is made of monomers called nucleotides 3. There are two differences.
From Gene To Protein Chapter 17. From Gene to Protein The “Central Dogma of Molecular Biology” is DNA  RNA  protein Meaning that our DNA codes our RNA.
Sections 3-4. Structure of RNA Made of nuleotides Three differences between DNA & RNA Sugar DNA = deoxyribose sugar RNA = ribose sugar RNA is single stranded.
Protein Synthesis. Transcription DNA  mRNA Occurs in the nucleus Translation mRNA  tRNA  AA Occurs at the ribosome.
 The central concept in biology is:  DNA determines what protein is made  RNA takes instructions from DNA  RNA programs the production of protein.
THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN
Chapter 13: RNA and Protein Synthesis RNA. What is RNA? RNA (Ribonucleic Acid) – How is RNA physically different from DNA? 1. Single strand not a double.
Chapter 14.  Ricin (found in castor-oil plant used in plastics, paints, cosmetics) is toxic because it inactivates ribosomes, the organelles which assemble.
I. Protein Synthesis (2 stage processing of information from DNA to proteins) = gene expression.
Jeopardy DNAs mRNA Amino Acids ETC Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final Jeopardy tRNA.
Ch 17 From Gene to Protein Proteins: the links from genotype to phenotype.
Translation- taking the message of DNA and converting it into an amino acid sequence.
Chapter 13 GENE FUNCTION. A. Comparison of DNA & RNA.
KEY CONCEPT 8.5 Translation converts an mRNA message into a polypeptide, or protein.
Chapter 12 Protein Synthesis. Central Dogma: DNA  RNA  Protein (the flow of genetic information)
Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.
Chapter 17 From Gene to Protein.
RNA and Protein Synthesis
RNA and Protein Synthesis
Gene Expression: From Gene to Protein
Transcription and Translation
Forensic DNA Analysis Protein Synthesis.
Protein Synthesis.
Chapter 10 How Proteins are Made.
Chapter 13 packet: DNA and Protein Synthesis Part II
Chapter 13: Protein Synthesis
Protein Synthesis Jeopardy!
In: What are INTRONS and EXONS again?
Chapter 14~ From Gene to Protein
Translation Now that the mRNA is created, we must translate that information into protein. Transfer RNA (tRNA) will be used in this process. This process.
Transcription & Translation.
Chapter 10 How Proteins Are Made.
Gene Expression: From Gene to Protein
How Proteins are Made.
UNIT 5 Protein Synthesis.
Protein Synthesis Step 2: Translation
Translation (Protein Synthesis) RNA  protein.
Protein Synthesis.
CHAPTER 10 Molecular Biology of the Gene
Chapter 17~ From Gene to Protein
CHAPTER 17 FROM GENE TO PROTEIN.
Unit 7 Part 2 Notes: From Gene to Protein
Protein synthesis.
Lecture #7 Date _________
Chapter 14: Protein Synthesis
Presentation transcript:

Biology Chapter 8.5-8.7 Review Aminno Acids mRNAns Misc Vocabulary Mutation Q $100 Q $100 Q $100 Q $100 Q $100 Q $200 Q $200 Q $200 Q $200 Q $200 Q $300 Q $300 Q $300 Q $300 Q $300 Q $400 Q $400 Q $400 Q $400 Q $400 Q $500 Q $500 Q $500 Q $500 Q $500 Final Jeopardy

$100 Question Amino Acids How many amino acids are Used to make all the proteins The body uses?

$100 Answer Amino Acids 20

$200 Question Amino Acids How many amino acids are built in this Line of mRNA augccauaugcgguaacadaguag

$200 Answer Amino Acid augccauaugcgguaacacaguag One start AUG One end UAG 6 amino acids augccauaugcgguaacacaguag

$300 Question Amino Acids What are the three nucleitide Bases called that identify an Amino acid?

$300 Answer Amino Acid Triplet codon

$400 Question Amino Acid What molecule carries the amino acid coded by mRNA to the ribosome? ?

$400 Answer Amino Acid tRNA

$500 Question Amino Acid What anticodon pairs with the codon AUG?

$500 Answer Amino Acid TAC

What happens if the mRNA reading frame is changed??

$100 Answer mRNA The amino acid sequence of the resulting protein changes.

$200 Question mRNA What forms the peptide bonds that link amino acids in a protein??

$200 Answer mRNA ribosome

$300 Question mRNA How does the lac operon switch off?

$300 Answer mRNA A repressor protein binds to the operator.

$400 Question mRNA What does NOT happen during mRNA processing $400 Question mRNA What does NOT happen during mRNA processing? A) introns are cut out B) a cap and tail are added c) exons are removed d) exons are spliced together

$400 Answer mRNA C) Exons are removed

$500 Question mRNA What determines the order of Amino acids ina protein?

$500 Answer mRNA The order of the mRNA anticodons

$100 Question Misc. What is the function of transcription factors in eukaryotic cells?

$100 Answer Misc They help RNA polymerase know where a gene starts

$200 Question Misc Genes determine a person’s Eye color by coding for _________ That affect eye color?

$200 Answer Misc proteins

$300 Question Misc Why type of bond are created during Dehydration synthesis?

$300 Answer Misc Polypeptide bonds

$400 Question Misc Of the 20 amino acids, 12 are found in the cell And the remaiinng 8 are made from? a)Proteins floating in the cytoplasm b) Water c) Hydrogen d) The food we eat

$400 Answer Misc d) From the food we eat

$500 Question Misc Proteins are sometimes called?

$500 Answer Misc Polypeptide chains

$100 Question Vocabulary Define mutagen

$100 Answer Vocabulary Agents in the environment that can change DNA

$200 Question Vocabulary What is a mutation?

$200 Answer Vocabulary Change in the organism’s DNA

$300 Question Vocabulary What is frameshift?

$300 Answer Vocabulary Insertion or deletion of A nucleotide in DNA

$400 Question Vocabulary What is Point Mutation?

$400 Answer Vocabulary One nucelotide is substituted For another

$500 Question Vocabulary What is chromosomal mutation?

$500 Answer Vocabulary Different sized units that have no copy of the gene

$100 Question Mutation Cystic Fibrosis is an example of a genetic disease caused by a deletion of a nucleotide . What is the term for this type of mutation?

$100 Answer Mutation frameshift

What type of mutation has no Effect on phenotype? $200 Question Mutation What type of mutation has no Effect on phenotype?

$200 Answer Mutation Translocation

$300 Question Mutation Which is an example of a mutagen? Triglyceride UV sunlight Thymine

$300 Answer Mutation UV Sunlight

$400 Question Mutation Mutations that can affect Offspring occur in what Cell type?

$400 Answer Mutation Chromosomal

$500 Question Mutation List two causes of mutations

b) Environmental Impact on epigenome c) Frame shift d) Point mutation $500 Answer Mutations a) Inheritated b) Environmental Impact on epigenome c) Frame shift d) Point mutation

Final Jeopardy What is the difference between Transcription and translation?

Final Jeopardy Answer Transcription is when the Nucleotide T is changed to U for mRNA Translation is when the triplet Codon is “read” to create a protein