English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 ÜThursday 10:15-11:45 (start: Oct. 23) Next.

Slides:

Advertisements

Similar presentations

Recombinant DNA Technology

Advertisements

Microarray Technology and Applications

BiGCaT Bioinformatics Hunting strategy of the bigcat.

Biology and Cells All living organisms consist of cells. Humans have trillions of cells. Yeast - one cell. Cells are of many different types (blood, skin,

Introduction to Microarray Gene Expression

Microarray Simultaneously determining the abundance of multiple(100s-10,000s) transcripts.

Microarray technology and analysis of gene expression data Hillevi Lindroos.

Microarray Data Analysis Stuart M. Brown NYU School of Medicine.

Gene Expression Chapter 9.

Getting the numbers comparable

DNA microarray and array data analysis

DNA Microarray Bioinformatics - #27612 Normalization and Statistical Analysis.

Chip arrays and gene expression data. With the chip array technology, one can measure the expression of 10,000 (~all) genes at once. Can answer questions.

The Human Genome Project and ~ 100 other genome projects:

Microarray Technology Types Normalization Microarray Technology Microarray: –New Technology (first paper: 1995) Allows study of thousands of genes at.

Polymerase chain reaction: Starting with VERY SMALL AMOUNTS OF DNA (sometimes a few molecules), one can amplify the DNA enough to detect it by electrophoresis.

Alternative Splicing As an introduction to microarrays.

Arrays: Narrower terms include bead arrays, bead based arrays, bioarrays, bioelectronic arrays, cDNA arrays, cell arrays, DNA arrays, gene arrays, gene.

CISC667, F05, Lec24, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) DNA Microarray, 2d gel, MSMS, yeast 2-hybrid.

What are microarrays? Microarrays consist of thousands of oligonucleotides or cDNAs that have been synthesized or spotted onto a solid substrate (nylon,

Modeling Functional Genomics Datasets CVM Lesson 1 13 June 2007Bindu Nanduri.

Introduce to Microarray

Gene Expression Data Analyses (1) Trupti Joshi Computer Science Department 317 Engineering Building North (O)

Genomics I: The Transcriptome RNA Expression Analysis Determining genomewide RNA expression levels.

Microarrays: Basic Principle AGCCTAGCCT ACCGAACCGA GCGGAGCGGA CCGGACCGGA TCGGATCGGA Probe Targets Highly parallel molecular search and sort process based.

and analysis of gene transcription

A Quantitative Overview to Gene Expression Profiling in Animal Genetics Armidale Animal Breeding Summer Course, UNE, Feb Affymetrix GeneChips Oligonucleotide.

Affymetrix vs. glass slide based arrays

Evolva Biotech SA Microarray and Macro opportunities for Discovery informatics Head of Informatics Mobile.

‘Omics’ - Analysis of high dimensional Data

A cell and its population of genes :. DNA forms double strands by a process called hybridization:

DNA microarrays Each spot contains a picomole of a DNA ( moles) sequence.

CDNA Microarrays MB206.

Data Type 1: Microarrays

Gene expression and DNA microarrays Old methods. New methods based on genome sequence. –DNA Microarrays Reading assignment - handout –Chapter ,

Gene Expression Data Qifang Xu. Outline cDNA Microarray Technology cDNA Microarray Technology Data Representation Data Representation Statistical Analysis.

Microarray Technology

Literature reviews revised is due4/11 (Friday) turn in together: revised paper (with bibliography) and peer review and 1st draft.

Microarray - Leukemia vs. normal GeneChip System.

Introduction to DNA microarray technologies Sandrine Dudoit, Robert Gentleman, Rafael Irizarry, and Yee Hwa Yang Bioconductor short course Summer 2002.

Microarrays and Gene Expression Analysis. 2 Gene Expression Data Microarray experiments Applications Data analysis Gene Expression Databases.

Genomics I: The Transcriptome

GeneChip® Probe Arrays

MICROARRAY TECHNOLOGY

Gene Expression Analysis. 2 DNA Microarray First introduced in 1987 A microarray is a tool for analyzing gene expression in genomic scale. The microarray.

Introduction to Microarrays.

Idea: measure the amount of mRNA to see which genes are being expressed in (used by) the cell. Measuring protein might be more direct, but is currently.

Microarray Technology. Introduction Introduction –Microarrays are extremely powerful ways to analyze gene expression. –Using a microarray, it is possible.

Microarray (Gene Expression) DNA microarrays is a technology that can be used to measure changes in expression levels or to detect SNiPs Microarrays differ.

Microarray hybridization Usually comparative – Ratio between two samples Examples – Tumor vs. normal tissue – Drug treatment vs. no treatment – Embryo.

Introduction to Microarrays Kellie J. Archer, Ph.D. Assistant Professor Department of Biostatistics

Introduction to Microarrays. The Central Dogma.

Overview of Microarray. 2/71 Gene Expression Gene expression Production of mRNA is very much a reflection of the activity level of gene In the past, looking.

DNA Gene A Transcriptional Control Imprinting Histone Acetylation # of copies of RNA? Post Transcriptional Processing mRNA Stability Translational Control.

Proteome and Gene Expression Analysis Chapter 15 & 16.

ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.

Lecture 23 – Functional Genomics I Based on chapter 8 Functional and Comparative Genomics Copyright © 2010 Pearson Education Inc.

Gene expression and DNA microarrays No lab on Thursday. No class on Tuesday or Thursday next week –NCBI training Monday and Tuesday –Feb. 5 during class.

DNA Microarray Overview and Application. Table of Contents Section One : Introduction Section Two : Microarray Technique Section Three : Types of DNA.

Functional Genomics Carol Bult, Ph.D. Course coordinator The Jackson Laboratory Winter/Spring 2011 Keith Hutchison, Ph.D. Course co-coordinator.

Introduction to Oligonucleotide Microarray Technology

Microarray: An Introduction

Microarray Technology and Data Analysis Roy Williams PhD Sanford | Burnham Medical Research Institute.

Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.

The Central Dogma. Life - a recipe for making proteins DNA protein RNA Translation Transcription.

Microarray Technology and Applications

Introduction to Microarrays.

Gene Expression Analysis

Data Type 1: Microarrays

Presentation transcript:

English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 ÜThursday 10:15-11:45 (start: Oct. 23) Next semester: Praktikum + Seminar Thereafter possibility for Masters thesis. Anwesenheitspflicht in VL und Ü (Liste!) Literature: See course web page.

121. Okt Microarray-Technologien Martin Vingron 228. OktGrundlagen der DatenanalyseChristine Steinhoff 34. NovVarianzanalyse IChristine Steinhoff 411. NovVarianzanalyse IIChristine Steinhoff 518. NovLOWESS, VarianzstabilisierungAnja von Heydebreck 625. NovStatistisches TestenAnja von Heydebreck 72. DezClusterverfahren Anja von Heydebreck 89. DezKlassifikation, Lin. DiskriminanzanalyseRainer Spang 916. DezAnwendungen in der KrebsforschungRainer Spang 106. JanHauptkomponentenanalyse Martin Vingron JanStatistische Lerntheorie Rainer Spang JanSequenzannotationRainer Spang JanBayessche NetzwerkeRainer Spang FebRegulation Martin Vingron FebZusammenfassung, Wiederholung, Ausblick

Functional Genomics: Genome Sequencing: Determination of DNA sequence Derivation of amino acid sequences Analysis, comparison, classification Study of gene function gene expression studies proteomics metabolic networks

DNA gene transcription messenger RNA (mRNA) protein sequence structure translation

A cell and its population of genes :

What is the problem? Determine the amount of mRNA for each gene that is present in a cell/tissue.

DNA forms double strands by a process called hybridization:

Labeling

Hybridization

Expression Arrays cDNA ArraysOligonucleotide Arrays Glas ArraysMembrane based Arrays

Glass Slide Microarrays … were first produced at Stanford University (Schena et al, 1995). Whole cDNA: bp

Filter Macroarrays … were first published by Lennon and Lehrach, 1991 Ca 21 cm 7.5x2.5cm

Oligonucleotide Arrays … were first published by Lockhardt et al, PM MM probe pair probe set probe cell... TGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCC TTACCCAGTCTTCCTGAGGATACAC TTACCCAGTCTTGCTGAGGATACAC ca 25bp

G C A C G C A C G C A C G C A C G C A C G C A C Probe - Reference G C A C G C A C

There are other technologies, too, to estimate expression levels: EST sequencing – electronic northern SAGE: tags of mRNAs are concatenated and sequenced Reliability of results depends on depth of probing (number of ESTs, number of tags)

Why do we want to know? tissue profiling: which genes are expressed in a tissue Comparing healthy and diseased (e.g., tumor) tissue Studying dynamic processes: E.g., cell cycle (time series)

Example: Renal clear cell carcinoma Comparison of kidney cancer cells to normal tissue. Which genes are altered in their expression?

T N Molecular Genome Analysis Dr. Judith Boer

G1 S G2 M Spellman et al took several samples per time-point and hybridized the RNA to a glass chips with all yeast genes Example: Cell cycle time course

Data processing Image collection Image analysis, intensity determination Within slide normalization

Trends in Biotech Hess et al, 19(11),2001

OUPUT: Scanner + Scanner-Software... Trends in Biotech Hess et al, 19(11),2001

Different technologies Support: membrane or glass slide Spotted material: PCR product or oligo (short/long) Labeling: –1-channel: radioactive, Affy –Absolute values –2-channel: 2 color fluorescent labeling –Relative values

Quality issues

subpopulations: PCR Remedies: improve PCR protocols; model random effect through plate-wise calibration Remedies: improve PCR protocols; model random effect through plate-wise calibration

subpopulations: pin Remedies: handling of pins; pin-wise calibration

Distribution of intensities: log-normal? intensitieslog intensities QQPlot Histogramm

Chip design Type of chip: –Global whole genome (yeast, drosophila, mouse, man) –Domain specific, e.g. cancer, infection Spots: –PCR products: E.g., 3´ UTR (avoid crosshyb.) –Oligos: uniqueness, stability

Databases Stanford TIGR Gene expression atlas GEO Arrayexpress MIAME standard: Minimum Information About a Microarray Experiment

Software R + Bioconductor Jexpress Genesprings Rosetta Resolver

Affymetrix technology Per gene, spot 20 perfectly matching oligos and 20 oligos with 1 mismatch Intensity: weighted average of pixel intensities in perfect and mismatch oligos (More on this next week)