Characterization of the morphological, phenotypic, and molecular effects of 17α- ethynylestradiol exposure during early development in Xenopus laevis Amber.

Slides:



Advertisements
Similar presentations
Copyright © 2006 Pearson Education, Inc., publishing as Benjamin Cummings M I C R O B I O L O G Y a n i n t r o d u c t i o n ninth edition TORTORA  FUNKE.
Advertisements

*** SC Weight (g) *** SC0.115 TPTCl Concentration (ug/L) Length (mm) Wood Frog Weight and SVL at day 7 Eric Higley.
TRICLOSAN : environmental exposure, toxicity and mechanisms of action Journal of Applied Toxicology 31: , 2011 Dann and Hontela Innovation Lectures.
Amphibian Metamorphosis: A Sensitive Model for Examining the Developmental Effects of Ammonium Perchlorate. James A. Carr, Ph.D. Department of Biological.
Peter Tsai Bioinformatics Institute, University of Auckland
Sexually dimorphic gene expression in somatic tissues. Authors: J. Isensee and P.Ruiz Noppinger Center for Cardiovascular Research, Center for Gender in.
Atrazine-Induced Hermaphroditism
The Unfolded Protein Response in C. Elegans Biology 314, Advanced Cell Biology, Spring 2004.
Bacterial Physiology (Micr430)
Modeling Functional Genomics Datasets CVM Lesson 1 13 June 2007Bindu Nanduri.
PLANT BIOTECHNOLOGY & GENETIC ENGINEERING (3 CREDIT HOURS)
Unit 4 Genetics Ch. 14 The Human Genome.
Whole genome transcriptome variation in Arabidopsis thaliana Xu Zhang Borevitz Lab Whole genome transcriptome variation in Arabidopsis thaliana Xu Zhang.
Sex Linked Traits Humans have 23 pairs of chromosomes.
with an emphasis on DNA microarrays
Biology 12. Inheritance Organisms inherit characteristics from their parents Characteristics are controlled by DNA In asexual reproduction, organisms.
SRY Gene on Chromosome Y Jon Scales Genetics Fall GTAACAAAGAATCTGGTAGAAGTGAGTTTTGGATAGTAAAATAAGTTTCGAACTCTGGCA 61 CCTTTCAATTTTGTCGCACTCTCCTTGTTTTTGACAATGCAATCATATGCTTCTGCTATG.
Committee Meeting April 24 th 2014 Characterizing epigenetic variation in the Pacific oyster (Crassostrea gigas) Claire Olson School of Aquatic and Fishery.
Assessing the Effects of Naphthenic Acids Using a Microbial Genome Wide Live Cell Reporter Array System Xiaowei Zhang 1,2 *, Steve Wiseman 2, Hongxia Yu.
Background  The soft shell clam, Mya arenaria, currently occupies a large geographical range in the northern hemisphere.  Soft shell clams are found.
Gene Expression Data Qifang Xu. Outline cDNA Microarray Technology cDNA Microarray Technology Data Representation Data Representation Statistical Analysis.
Methodology Control (no treatment) Estrogen (5 uM) 4-nonylphenol (5 uM) Cultured Cells, Isolated RNA, RTed to cDNA Data analyzed by Spotfire software RT-PCR.
Wildlife Screens What Do They Tell Us? Dr. Pat Guiney Manager Global Safety, Regulatory & Environmental Assessment S.C. Johnson & Son, Inc. Racine, WI.
Development and Application of SNP markers in Genome of shrimp (Fenneropenaeus chinensis) Jianyong Zhang Marine Biology.
Molecular Biology in a Nutshell (via UCSC Genome Browser) Personalized Medicine: Understanding Your Own Genome Fall 2014.
Environmental impact assessment of steroid hormones R. Laenge, LGE 09 June 2006 Assessment of the impact of selected steroid hormones on biodiversity Reinhard.
Genomics and Arabidopsis. What is ‘genomics’? Study of an organism’s entire genome –All the DNA encoded in the organism –Nucleus, mitochondria, chloroplasts.
0 Focusing on the Adverse Outcomes of ER-mediated Pathways Rodney Johnson ORD/MED McKim Conference September 16-18, 2008.
Experimental Design and Data Structure Supplement to Lecture 8 Fall
Molecular biology and evolution in genomics era Li Jun and Frederick C.C. Leung 5N01, School of Biological Science, The University.
Interconversion of Hydroxylated and Methoxylated Polybrominated Diphenyl Ethers in Japanese Medaka Yi Wan 1, Steve Wiseman 1, Fengyan Liu 1, Xiaowei Zhang.
KEY CONCEPT Biotechnology relies on cutting DNA at specific places.
Comparative Hepatic Gene Expression Elicited by o,p’-DDT in the Rat and Mouse INTRODUCTION Technical grade dichlorodiphenyltrichloroethane (DDT), a mixture.
Chapter 2 From Genes to Genomes. 2.1 Introduction We can think about mapping genes and genomes at several levels of resolution: A genetic (or linkage)
POLLUTION BY XENOBIOTICS : BIOMARKERS FOR EARLY DETECTION OF POLLUTION EFFECTS Ibon Cancio EUSKALHERRIKOUNIBERTSITATEA UNIVERSITY OF THE BASQUE COUNTRY.
ANALYSIS OF GENE EXPRESSION DATA. Gene expression data is a high-throughput data type (like DNA and protein sequences) that requires bioinformatic pattern.
Morphometric and phenotypic effects of 17α-ethynylestradiol exposure in the wood frog (Rana sylvatica) A.R. Tompsett 1, E. Higley 1, S. Wiseman 1, H. Chang.
ESTs Ian Keller Laboratory Techniques in Molecular Bio.
No reference available
 RNA: Ribonucleic Acid  3 types  Helps cells make protein  Single strand of nucleotides: › Ribose sugar › Phosphate › Nitrogen bases  Adenine, uracil,
Methodology U937 Human Immune Cells Control (No treatment) (n=4) Estrogen (5 uM) (n=4) 4-nonylphenol (5 uM) (n=4) Cultured Cells, RNA Isolation, RT (to.
Dose Response Study of Masculinizing Effects of Estradiol (E 2 ) Student Goals: -to see if we can replicate sex differences -to gauge the sensitivity of.
Statistical Analysis for Expression Experiments Heather Adams BeeSpace Doctoral Forum Thursday May 21, 2009.
Mechanistic toxicity study of perfluorooctanoic acid in zebrafish suggests mitochondrial dysfunction to play a key role in PFOA toxicity Chemosphere xxx.
We thank the Office of Research and Sponsored Programs for supporting this research, and Learning & Technology Services for printing this poster. An Approach.
Risheng Chen et al BMC Genomics
Drug Candidate-Induced Changes in the Thyroid Gland: Contrasting Case Studies Joan Lane, Katie Zokowski, Jeffrey Horrigan, Daniel Aleksandrowicz, Doriana.
Mahmuda Akter, Paige Fairrow-Davis, and Rebecca Seipelt-Thiemann
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Biotechnology.
Using DNA Subway in the Classroom
Location of Genes and Gene Expression
Detection of tissue- and sex-specific gene expression
Understanding and Validating Experimental Expectations
Gene expression.
Figure 1. Effect of acute TNF treatment on transcription in human SGBS adipocytes as assessed by RNA-seq and RNAPII ChIP-seq. Following 10 days in vitro.
Scientists use several techniques to manipulate DNA.
The great variety of possible gene combinations in a
CHAPTER 12 DNA Technology and the Human Genome
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
MRNAs that show increased protein synthesis following UPF1 depletion are enriched for those with very long 3′UTRs. mRNAs that show increased protein synthesis.
Single Cell Regulatory Variation
The Regulation of the Drosophila msl-2 Gene Reveals a Function for Sex-lethal in Translational Control  Greg J Bashaw, Bruce S Baker  Cell  Volume 89,
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Early Onset of Severe Familial Amyotrophic Lateral Sclerosis with a SOD-1 Mutation: Potential Impact of CNTF as a Candidate Modifier Gene  Ralf Giess,
OSPW After Ozonation with 80 mg O3/L
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Molecular Therapy - Nucleic Acids
Presentation transcript:

Characterization of the morphological, phenotypic, and molecular effects of 17α- ethynylestradiol exposure during early development in Xenopus laevis Amber Tompsett, Steve Wiseman, Eric Higley, Hong Chang John P. Giesy, and Markus Hecker SETAC North America Annual Meeting Portland, OR, USA November 7-11, 2010 Toxicology Centre, University of Saskatchewan

Introduction Estrogenic chemicals in the environment – Exposure hypothesized to cause adverse effects Feminization/demasculinization of males – Wide variety of species are affected by exposure 17α-ethynylestradiol (EE2) – Potent estrogen of environmental concern – Present in oral contraceptives Not fully removed by conventional sewage treatment Detectable in surface water

Introduction Xenopus laevis – Common laboratory amphibian – Exquisitely sensitive to estrogenic exposures during sexual differentiation Male-to-female phenotypic sex reversal Recently discovered sex-linked gene EE2 and X. laevis used as model systems – Morphological and phenotypic effects of EE2 exposure – Molecular effects underlying sex reversal

Experimental design Dosing Regime* – FETAX control and % ethanol solvent control – 0.1, 1, and 10 µg/L EE2 Tadpole samples – Near sexual differentiation Experiment terminated at 96 d – Morphometrics and phenotyping – Molecular samples – Histological samples *Estrogen equivalent concentrations in surface water normally range from 3-30 ng/L

Days to Metamorphosis Survival analysis followed by ANOVA, post-hoc Tukey’s test; significant differences (p<0.05) denoted by different letters a a b b b

Phenotyping: Gross Morphology a a b b b Fisher’s Exact Tests; significant differences denoted by different letters

DM-W Based Genotypic Sexing X. laevis has ZW chromosomal sex determination – ZW female; ZZ male – DM-W resides on the W chromosome Multiplex DM-W/DMRT1 PCR genotyping – Genomic DNA – PCR products visualized on a gel ♀ ♂ DM-W DMRT1

Genotypic Sex Ratios *Initial data from a subsample of EE2 treated animals.

Initial Comparison of Genotyping and Phenotyping

2 O 1 O 3 T T 1.Genetic female 2.Sex-reversed genetic male 3.Genetic male Gross Phenotypic Morphology

Transcriptome Analysis Nieukwoop-Faber Stage 53 Tadpoles – Undergoing sexual differentiation – Control and 100 µg/L EE2 treated animals Male genotype Illumina Sequencing – RNA Seq – Single-end read – 75 bp read length

Initial Transcriptome Analysis CLC Genomics Workbench – Reads filtered and trimmed – Mapped to X. laevis published mRNAs – Expression analysis General Statistics – 70% of reads mapped to an mRNA transcript – 95% of transcripts were detected at least once

Transcriptome Analysis Overview of changes 73% 12% 15% 22 genes upregulated at least 15-fold 66 genes downregulated at least 15-fold

Types of Genes Impacted Up-regulated – Estrogen/steroid hormone metabolism – Cardiac/skeletal muscle contraction and growth – DNA repair Down-regulated – Redox metabolic activity – Axonogenesis and synaptogenesis – Metabolism of neurotransmitters

Potential Genes of Interest GeneFold Change Estrogen sulfotransferase (sult1e1)+19 Frizzled-related protein (frzb-1)+24 Troponin T Type 3 (tnnt3)+37 Cu-Zn superoxide dismutase (sod)-23 Synaptosomal associated protein 25 (snap-25) -85 Sulfotransferase 4a1 (sult4a1)-23

Biological Relevance of EE2 Exposure Male-to-female sex reversal May impact individual fitness – Delayed metamorphosis and smaller size Changes in the male transcriptome at sexual differentiation – Estrogen/hormone metabolism – Other processes

Additional Ongoing Analysis Histology of gonads – Gross morphology of small animals unclear Parallel wood frog experiment – Native, non-model species

Acknowledgements Toxicology Centre – ETL and ATRF – Jon Doering – Jason Raine Canada Research Chairs Program

Froglet Weight at Termination Note: There were no significant differences in length at termination a ab bc

Ambiguous Phenotype EE2 Treated Genetic Male – Segmented Testes 2.Control Genetic Female – Ambiguous ovary T T O

Summary of Results Morphometrics – Metamorphosis of EE2 exposed tadpoles was delayed – EE2 exposed froglets tended to be smaller at termination Phenotypic Sex – Phenotypic sex ratios were female biased in all EE2 treatments – 10 µg/L EE2 impaired sexual development of all genetic males Genotypic Sex – Initial results indicate sex ratios are constant across treatments – Definitive identification of sex reversed genetic males Transcriptomics – Of detected transcripts, 28% impacted by EE2 exposure Up- or down-regulated by at least 2-fold – Various biological processes impacted, including estrogen metabolism