Chapter 12 The Structure of DNA
DNA the Genetic Carrier! Now, thanks to Griffith, Avery, Hershey and Chase’s experiment Biologists are equipped with the knowledge that DNA carries genetic information. Biologist hoped to understand genetics better if they understood the structure of DNA. There was a new race against time and other Biologist to discover the structure of DNA
Watson & Crick Watson & Crick were credited with discovering the structure of DNA. They determined that DNA was a molecule in the shape of a double helix. Double helix – Two strands wrapped around each other like a winding staircase. DNA is a Nucleic acid which means that it is made of… Nucleotides!
Watson & Crick’s “Helpers” Watson & Crick were in a race with other biologists to come up with the structure of DNA. It was kind of like finding a cure for a deadly disease. But Watson and Crick were “helped” by two people. Maurice Wilkins and Rosalind Franklin.
“Photo 51”
Nucleotides The Nucleotides of DNA are made of three parts. Phosphate Group Sugar (deoxyribose) One of four Nitrogen Bases Adenine Guanine Cytosine Thymine
The Structure of DNA The backbone of DNA is made of alternating Phosphate groups and Pentose Sugars. The “rungs” of the ladder are made of one of the four different Nitrogenous bases.
Erwin Chargaff The number of Adenine molecules was always equal to the number of Thymine molecules The number of Guanine molecules was always equal to the number of Cytosine molecules. However The numbers of Guanine & Thymine and the numbers of Cytosine & Adenine were independent of each other.
Chargaff continued 1345 Adenine = 1345 Thymine 14 Cytosine = ? Adenine This lead the scientific community to believe that Adenine & Thymine pair up with each other as well as Cytosine & Guanine. This became known as the base-pairing rule. The two strands are complementary to each other. That means the sequence of bases on one strand determines the sequence on the other.
Notice that Thymine & Adenine form two Hydrogen bonds whereas Guanine & Cytosine make three.
The Nitrogenous Bases Guanine and Adenine are known as Purines. Purines are made of 2 rings. Thymine and Cytosine are known as Pyrimidines. Pyrimidines are made of 1 ring.
Write the complimentary base pairs for the following template. AGCTATTGGCACCGGGCTATTAATTCCG
Class Size DNA Project! Create two nucleotides of your own As a class, make a DNA strand with the following code: AAGTGCCTAGCTCAGGTACTGA Hint: Figure out the complementary strand first!