Chapter 11.3 Genetic Changes.

Slides:



Advertisements
Similar presentations
KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.
Advertisements

Chapter 8 Section 8.7: Mutations.
Mutations.
Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
Genes and Chromosomes. DNA: The Molecule of Heredity Scientists have found that the substance Deoxyribosenucleic Acid (DNA), contained in chromosomes,
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
DNA (Gene) Mutations. What is a gene mutation? Parts of DNA will have a base (or more) missing, added, or incorrect A mistake in the genetic code Wrong.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.
MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.
Mutations (12.4) State Standard
C11- DNA and Genes Chapter 11.
MUTATIONS Mutations can occur in DNA replication Protein Synthesis.
MUTATIONS.
Genetic Changes 11.3.
Mutations Genetic Changes.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.
What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
NOTES – CH 17, part 2 DNA & MUTATIONS
Mutations. What comes to mind???? Mutants.
Chapter 10: DNA, RNA, and Protein Synthesis. Objectives: Analyze and investigate emerging scientific issues (e.g., genetically modified food, stem cell.
DNA Mutations. What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA? CACGTGGACTGAGGACACCTC.
Mutations that happen during Transcription and Translation
Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.
4.2 Mutation.
Chapter 11 DNA. What is DNA? Living things need proteins to survive. –most proteins are enzymes DNA provides the complete set of instructions for making.
MUTATIONS. Mutant An organism expressing a mutated gene.
Mutations Mutations are changes in DNA Mutations are changes in DNA These can occur in: These can occur in: Somatic cells – can cause tumours/cancersSomatic.
From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcriptiontranslation.
Nucleic Acids & Protein Synthesis DNA (Deoxyribonucleic acid)
Mutation Notes: Chapter 11.
Section 11.3: Genetic Changes
Mutation Notes Chapter 12-4.
11.3 Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
A change in the DNA sequence that affects genetic information
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mutations.
Genetic Mutations.
A change in the DNA sequence that affects genetic information
Mutations LN #23 Ms. Garcia California Content Standard Genetics
Mutation Lecture 11 By Ms. Shumaila Azam
Chapter 13: Genes & Chromosomes
11.3 Section Objectives – page 296
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.
DNA & Protein Synthesis
Mutations.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Mechanisms for the Diversity of Life
Mutations A mutation is any change in the DNA sequence.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Genetic Mutations Karyotype: the number and visual appearance of the chromosomes in the cell nuclei of an organism or species.
Mutations A mutation is any change in the DNA sequence.
Chapter 12-4 DNA Mutations.
DNA Mutations.
10th Grade Biology Mr. Walker
11.3 Section Objectives – page 296
Presentation transcript:

Chapter 11.3 Genetic Changes

Mutations Sudden genetic change Point mutations Frameshift mutation Chromosomal mutation www.chemistryexplained.com/images/chfa_03_img

www.catpaws.dk/images/mutation.jpg

Point Mutation Single base pair in DNA Ex: Normal – AUG AAG UUU GGC Point - AUG AAA UUU GGC Happens at a single point, you point to one thing.

Frameshift Mutation Addition or deletion of a single base Ex: Normal – AUG AAG UUU GGC Frameshift – AUG AAG UU GGC Think KEYBOARD

Chromosomal Mutation Change in chromosomes Causing nondisjunction (to many or not enough parts) – failure of chromosomes to separate Trisomy – extra chromosome Monosomy – missing chromosomes Triploidy – an extra set - plants mostly

Source: www.brooklyn.cuny.edu/.../MUT/Mut.Types.html

Mutations Some mutations can be positive – mutation may make an organism faster, stronger Mutations may be passed on if it occurs in reproductive cells, will not be passed on however in nonreproductive cells (skin, muscle, or bone.)

Mutagen Any agent that can cause a change in DNA

Causes of Mutations (Mutagens) Error in DNA Radiation – x-ray exposure, gamma radiation, cosmic rays, UV, nuclear Chemicals – dioxins, asbestos, benzene, cyanide, formaldehyde, radioactive chemicals

Results of Mutations Birth Defects Cancer

Repairing DNA Enzymes proofread the DNA and replace incorrect nucleotides with correct ones

Feedback: Privacy Policy Feedback
Do Not Sell My Personal Information
About project: SlidePlayer Terms of Service

© 2025 SlidePlayer.com. Inc. All rights reserved.