Molecular identification of living things
Molecular Markers Single locus marker Multi-locus marker RFLP Microsatellite DNA Fingerprinting AFLP RAPD
PCR reactions per se are only prelude to many forms of DNA methods: PCR-based methods RAPD: randomly amplified polymorphic DNA STR (= microsatellites): short tandem repeats AFLP: amplified fragment-length polymorphisms SNP: single nucleotide polymorphisms DNA sequencing
RAPD is a PCR-based method which employs single primers of arbitrary nucleotide sequence with 10 nucleotides to amplify anonymous PCR fragments from genomic template DNA What is RAPD?
RAPD technology A BC Genomic DNA + Taq polymerase + Arbitrary primers A + Nucleotides + Buffer PCR (under relaxed conditions)
Electrophoresis PCR 360 bp 260 bp 520 bp 260 bp 360 bp ABC ABC
A schematic picture of an agarose gel Plant AMarkerPlant B - + Plant C Monomorphic bands Polymorphic bands Presens of a band, ”1” Absence of a band, ”0”
RAPD bands are treated as independent loci: AA/ Aa aa bb BB/ Bb bb CC/ Cc cc CC/ Cc cc dd DD/ Dd dd DD/ Dd Locus A Locus B Locus C Locus D
RAPD bands are scored for presens ”1” and absens ”0”. Only clear, consistent and polymorphic bands are usually used to create a binary matrix for future statistical analyses
Band 1 Band 2 Band 3 Band 4 Plant A Plant B Plant C Plant D Plant E Plant F Plant G A binary matrix:
Amplified Fragment Length Polymorphism (AFLP) Restriction endonuclease digestion of DNA Ligation of adaptors Amplification of ligated fragments Separation of the amplified fragments via electrophoresis and visualization AFLPs have stable amplification and good repeatability
Technology with elemnts of PCR-based and RFLP-based methods Amplifies a subset of restriction fragments from a mixture of fragments produced by digestion of genomic DNA by two restriction endonucleases Fragments are linked to adapters sequences so that subsequent PCR amplifies only a subset of them (to manageable level) Polymorphisms due to length differences of fragments AFLP: amplified fragment length polymorphism
Restriction Fragment Length Polymorphism (RFLP) Genomic DNA digested with Restriction Enzymes DNA fragments separated via electrophoresis and transfer to nylon membrane Membranes exposed to probes labelled with P 32 via southern hybridization Film exposed to X-Ray
RFLP Restriction Fragment Length Polymorphism Cutting a DNA sequence using restriction enzymes into pieces specific enzymes cut specific places Starting DNA sequence: 5’-TAATTTCCGTTAGTTCAAGCGTTAGGACC 3’-ATTAAAGGCAATCAAGTTCGCAATAATGG Enzyme X 5’-TTC- 3”-AAG- Enzyme X 5’-TTC- 3”-AAG- 5’-TAATTT 3’-ATTAAA 5’-CCGTTAGTT 3’-GGCAATCAA 5’-CAAGCGTTAGGACC 3’-GTTCGCAATAATGG
Microsatellites
What are microsatellites? –Microsatellites (also known as SSR – Simple Sequence Repeats) Mononucleotide SSR (A)11 AAAAAAAAAAA Dinucleotide SSR (GT)6 GTGTGTGTGTGT Trinucleotide SSR (CTG)4 CTGCTGCTGCTG Tetranucleotide SSR (ACTC)4 ACTCACTCACTCACTC
Microsatellites What are microsatellites? –Homozygous …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… 5’ flanking regionmicrosatellite locus3’ flanking region –Heterozygous …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCT ATCGGTACTACGTGG… …CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG…
Microsatellites Where are microsatellites found? Majority are in non-coding region
SSR Analysis
SSR: Simple Sequence Repeat or Microsatellite PCR based markers with base pair primers SSR polymorphisms are based on no. of repeat units and are hypervariable SSRs have stable amplification and good repeatability SSR are easy to run and automate
Most accurate molecular technique, uses genetic blackprint (detects silent mutations and changes without length variation) Large selection of potential genes (mt DNA, nu DNA) but… expensive and time consuming and therefore only used for limited number of genes DNA sequencing
“PCR-mediated DNA sequencing has made some (but certainly not all) earlier methods for generating molecular markers, especially for phylogenetic purposes, nearly obsolete” (Avise, 2004) In recent years, DNA sequence information has increased explosively: by the beginning of 2003 nearly 25 million sequences representing taxa in GanBank! DNA sequencing
Amplification of a gene fragment by polymerase-chain-reaction (PCR) with specific primer combinations DNA sequencing
Primers Common mtDNA genes: - 12S rRNA 16S rRNA (structural) - cytochrome oxidase I, cytochrome-b (coding) DNA sequencing
Purification and Sequencing DNA sequencing
Phylogenetic reconstruction distance methods parsimony methods likelihood methods DNA sequencing