The Genetic Code Math-CS Camp, 19.07.06, Singapore Mikhail S. Gelfand Research and Training Center of Bioinformatics, Institute for Information Transmission Problems, Moscow, Russia and Department of Bioengineering and Bioinformatics, Moscow State University
The Biological Code by Martynas Yčas (London, 1969) Биологический код (Mосква, 1971) 191X 1956 18XX 190X 192X 193X 1941-45 1946-50 1951-55
To apply mathematics in biology, a mathematician has to understand biology. Israel Gelfand
Plan Pre-history Cracking the Code Update Genetics Evolutionary theory Chemistry Cracking the Code Update
Genetics: Gregor Mendel (1822-1884) Attended the Philosophical Institute in Olomouc Since 1843 – at the Augustinian Abbey of St. Thomas in Brno 1851-1853 – studied in the University of Vienna 1856-1863 – cultivated 28 thousand pea plants The Three Laws of Genetics (“Experiments on Plant Hybridization”) Read to the Natural History Society of Brunn in Bohemia (1865) Published in Proceedings of the Natural History Society (1866) Since 1866 – abbot, stopped working in science
The seven traits of pea plants studied by Mendel
The first law Crossing two pure lines different in some trait (e.g. yellow / green seeds), one gets only one variant (allele) in the first generation (the dominant allele) F0 F1
The second law Crossing two pure lines different in some trait (e.g. yellow / green seeds), one gets only one variant (allele) in the first generation (the dominant allele), and the distribution 3:1 of the dominant and recessive alleles in the second generation. F0 F1 F2
(Law of large numbers) F0 F1 F2 The 3:1 ratio is seen only when the number of observations is sufficiently high. F0 F1 F2
The third law Two different traits are inherited independently (in the second generation the ratio is 9:3:3:1) F0 F1 F2
F2
What if we take a pair with a different assortment of the same traits?
Same F1 F0 F0 F1 F1 F2
Same F2 … regardless of the initial assortment F0 F0 F1 F1 F2
Incomplete dominance
Incomplete dominance ?
Incomplete dominance ?
Incomplete dominance
Charles Darwin (1809-1882) 1825-27 in Edinburgh University and 1827-31 in University of Cambridge – natural history, geology, botany 1831-1836 – Voyage of the Beagle Journal of Researches into the Geology and Natural History of the various countries visited by H.M.S. Beagle (1839)
Origin of Species (1859)
The Law of Natural Selection Species make more offspring than can grow to adulthood. Populations remain roughly the same size. Food resources are limited, but are relatively constant most of the time. In such an environment there will be a struggle for survival among individuals. In sexually reproducing species, generally no two individuals are identical. Much of the variation is heritable. Individuals with the "best" characteristics will be more likely to survive … … those desirable traits will be passed to their offspring … … and then inherited by following generations, becoming prevalent and then fixed among the population through time.
Thomas Huxley (1825-1895) “Darwin’s Bulldog”
Origin of Homo sapiens
Re-discovery of the Mendel laws and emergence of modern genetics Hugo de Vries (1900) William Bateson genetics, gene, allele Walter Sutton Link between genes and chromosomes(1902) Archibald Garrod Genetic cause of some human disease (1902-08-23) Thomas Morgan, work on Drosophila. Mutants: spontaneous appearance of new alleles (a fly with white eyes in a population of flies with red eyes) (1908) Universal acceptance of chromosomes (1915)
Gene = a set of non-complementing mutations Edward Lewis: Do two recessive mutations occur in the same gene? F1: Mutant phenotype F1: Wild-type phenotype
F2 Mutant phenotypes persist in cis (same gene). Mutant phenotypes reappear in trans (different genes) F1: Mutant phenotype F2: All mutant phenotypes F1: Wild-type phenotype F2 WT WT Mut WT WT Mut Mut Mut Mut 1 2 1 2 4 2 1 2 1 9:7
DNA Friedrich Miescher (1869) Phoebus Levene (1929) Nucleolin Richard Altmann: nucleic acid (1889). Only in chromosomes Phoebus Levene (1929) Components (four bases, the sugar-phosphate chain) Nucleotide: phosophate+sugar+base unit Hammarsten and Casperson (1930s) DNA is a long polymer; crystals Astbury (1938) X-ray photographs Chargaff rules (1947) In many organisms, #A=#T, #C=#G
Transforming factor (Frederick Griffith,1928)
… = DNA (Oswald Avery, Colin McLeod, Maclyn MacCarthy,1944)
DNA is the genetic medium of phages (Alfred Hershey and Martha Chase, 1948) 32P – radioactive DNA 35S – radioactive proteins Only DNA enters the cell
… and only DNA is inherited by progeny phages
Erwin Schrödinger “What is life”, 1946: The gene is an aperiodic crystal
The structure of DNA … Maurice Wilkins and Rosalind Franklin: high-resolution crystals (1950-1953)
… is the double helix James Watson and Francis Crick (1953)
The Nature paper: a few lines more than one page
The DNA chain
Complementary pairs of nucleotides С G Т A
Figures from the second Watson-Crick paper
The main distances are the same
One base-pair in the double helix (axial view)
The double helix, stick and ball models, axial view
The double helix, stick and ball models, side view
Three models for the replication of DNA
The semi-conservative one is correct (Matthew Meselson and Franklin Stahl, 1958) Cells are grown on the 15N (heavy) medium for several generations, then transferred to 14N (light) medium Q: What would be the outcome if one of the two other models were correct?
Electron micrograph of replicating DNA
The Central Dogma (F.Crick) DNA RNA protein
Crossingover and recombination Genes from one chromosome are not inherited independently Recombination allows for relative mapping of gene positions on the chromosome: if two genes are close, the frequency of recombination will be lower
Collinearity of the gene and the protein (Charles Yanofsky, 1967)
The Genetic Code The genetic code: correspondence between DNA and protein (George Gamow, 1954) (Георгий Гамов) Crick and co-authors (1961): Non-overlapping (one mutation affects one amino acid) Degenerate (many codons for one amino acid) Comma-less (no specific markers between codons) Periodic
The codon is a triplet Mutations caused by acridine Non-leaky (instead of weakened function, simply no function) Mechanism: insertions and deletions of nucleotides (the downstream part of the gene completely scrambled the code is comma-less) CUACUACUACUACUACUACUACUACUACUACUACUACUA LeuLeuLeuLeuLeuLeuLeuLeuLeuLeuLeuLeuLeu insertion CUACUACUACGUACUACUACUACUACUACUACUACUACU LeuLeuLeuArgThrThrThrThrThrThrThrThrThr deletion CUACUACUACUACUACUACUACUACUACACUACUACUAC LeuLeuLeuLeuLeuLeuLeuLeuLeuHisTyrTyrTyr G U
Double mutants and revertants Two classes of mutations: (+) and (–) Double mutants (+)¤(+) and (–)¤(–) still produce loss-of-function phenotypes Double mutants (+)¤(–) and (–)¤(+) produce leaky phenotypes CUACUACUACGUACUACUACUACUACUACUACUACUACU LeuLeuLeuArgThrThrThrThrThrThrThrThrThr ¤ CUACUACUACUACUACUACUACUACUACACUACUACUAC LeuLeuLeuLeuLeuLeuLeuLeuLeuHisTyrTyrTyr CUACUACUACGUACUACUACUACUACUACACUACUACUA LeuLeuLeuArgThrThrThrThrThrThrLeuLeuLeu
Triple mutants are revertants! Triple mutants of the same class, (+)¤(+)¤(+) and (–)¤(–)¤(–), produce leaky phenotypes CUACUACUACGUACUACUACUACUACUACUACUACUACUACU LeuLeuLeuArgThrThrThrThrThrThrThrThrThrThr ¤ CUACUACUACUACUACUACGUACUACUACUACUACUACUACU LeuLeuLeuLeuLeuLeuArgThrThrThrThrThrThrThr double mutant – loss of function phenotype CUACAUCUACGUACUACUACGUACUACUACUACUACUACUAC LeuLeuLeuArgThrThrThrTyrTyrTyrTyrTyrTyrTyr CUACUACUACUACUACUACUACUACUACGUACUACUACUACU LeuLeuLeuLeuLeuLeuLeuLeuLeuArgThrThrThrThr triple mutant – leaky phenotype CUACUACUACGUACUACUACGUACUACUACGUACUACUACUA LeuLeuLeuArgThrThrThrTyrTyrTyrValLeuLeuLeu
Cracking the Code (F. Crick, M. Nirenberg, J. Matthaei, S. Ochoa, G Cracking the Code (F.Crick, M.Nirenberg, J.Matthaei, S.Ochoa, G.Khorana, … and you) Regular oligonucleotides … UUUUUUUUUU … … UCUCUCUCUC … … UCAUCAUCAU … Random oligonucleotides with known composition Changes in proteins caused by deamination-caused mutations: CU, AG Changes in proteins caused random mutations (tRNA binding in the presense of trinucleotides)
20 amino acids and 64 codons Alanine Cysteine Aspartate Glutamate Phenylalanine Glycine Histidine Isoleucine Lysine Leucine Methionine Asparagine Proline Glutamine Arginine Serine Threonine Valine Tryptophan Tyrosine UUU Phe UCU UAU UGU UUC UCC UAC UGC UUA UCA UAA UGA UUG UCG UAG UGG CUU CCU CAU CGU CUC CCC Pro CAC CGC CUA CCA CAA CGA CUG CCG CAG CGG AUU ACU AAU AGU AUC ACC AAC AGC AUA ACG AAA Lys AGA AUG ACA AAG AGG GUU GCU GAU GGU GUC GCC GAC GGC GUA GCA GAA GGA GUG GCG GAG GGG
Triplet binding data (from Crick’s Croonian lecture, 1966)
Reading the code: The ribosome
Translation
Polysomes
Adaptors (F.Crick and S.Brenner)
tRNA: secondary structure
tRNA: three-dimensional structure
tRNA and aminoacid-tRNA-synthetase
Initiation of translation
Translation start sites dnaN ACATTATCCGTTAGGAGGATAAAAATG gyrA GTGATACTTCAGGGAGGTTTTTTAATG serS TCAATAAAAAAAGGAGTGTTTCGCATG bofA CAAGCGAAGGAGATGAGAAGATTCATG csfB GCTAACTGTACGGAGGTGGAGAAGATG xpaC ATAGACACAGGAGTCGATTATCTCATG metS ACATTCTGATTAGGAGGTTTCAAGATG gcaD AAAAGGGATATTGGAGGCCAATAAATG spoVC TATGTGACTAAGGGAGGATTCGCCATG ftsH GCTTACTGTGGGAGGAGGTAAGGAATG pabB AAAGAAAATAGAGGAATGATACAAATG rplJ CAAGAATCTACAGGAGGTGTAACCATG tufA AAAGCTCTTAAGGAGGATTTTAGAATG rpsJ TGTAGGCGAAAAGGAGGGAAAATAATG rpoA CGTTTTGAAGGAGGGTTTTAAGTAATG rplM AGATCATTTAGGAGGGGAAATTCAATG
Translation start sites aligned dnaN ACATTATCCGTTAGGAGGATAAAAATG gyrA GTGATACTTCAGGGAGGTTTTTTAATG serS TCAATAAAAAAAGGAGTGTTTCGCATG bofA CAAGCGAAGGAGATGAGAAGATTCATG csfB GCTAACTGTACGGAGGTGGAGAAGATG xpaC ATAGACACAGGAGTCGATTATCTCATG metS ACATTCTGATTAGGAGGTTTCAAGATG gcaD AAAAGGGATATTGGAGGCCAATAAATG spoVC TATGTGACTAAGGGAGGATTCGCCATG ftsH GCTTACTGTGGGAGGAGGTAAGGAATG pabB AAAGAAAATAGAGGAATGATACAAATG rplJ CAAGAATCTACAGGAGGTGTAACCATG tufA AAAGCTCTTAAGGAGGATTTTAGAATG rpsJ TGTAGGCGAAAAGGAGGGAAAATAATG rpoA CGTTTTGAAGGAGGGTTTTAAGTAATG rplM AGATCATTTAGGAGGGGAAATTCAATG
Elongation
Termination of translation
Dialects The genetic code is not universal … but the differences are relatively minor … occur mainly in small genomes of organelles … and involve specific codon families. In many cases symmetry is increased, or entire families reassigned. Many changes involve stop codons
Reassignment CUN (=CUU, CUC, CUA, CUG): LeuThr Possible initiation codons in addition to AUG (Met): NUG (=GUG,UUG,CUG), AUN (=AUU,AUC,AUA) UAA, UAG: stop Gln
More symmetry AUU Ile AUC Ile AUA IleMet AUG Met AGU Ser AGC Ser AGA ArgSer AGG ArgSer UGU Cys UGC Cys UGA stopTrp UGG Trp
Vulnerable codon families CGU Arg CGC Arg CGA Arg none CGG Arg none AGU Ser AGC Ser AGA Arg Ser Gly stop AGG Arg Ser Gly stop none GGU Gly GGC Gly GGA Gly GGG Gly
Stop-containing families UGU Cys UGC Cys UGA stop Trp Cys Sec UGG Trp UAU Tyr UAC Tyr UAA stop Tyr Gln UAG stop Gln (Pyl)
How many letters are there in the English alphabet?
How many letters are there in the English alphabet? 26 (everybody knows) …
How many letters are there in the English alphabet? 26 (everybody knows) … … but we are discussing the book by Yčas …
How many letters are there in the English alphabet? 26 (everybody knows) … … but we are discussing the book by Yčas … … so everybody are naïve
How many amino acids? Chemists: hundreds many occur in proteins: post-translation modifications How many amino acids are encoded by DNA?
Crick:
Is formyl-methionine a “standard” amino acid? Occurs in bacteria at N-termini of all recently synthesized proteins (may be enzymatically removed later on) Has three codons: AUG, GUG, UUG unlike “inernal” methionine encoded only by AUG by the way, internal GUG encodes Valine and internal UUG encodes Leucine
Selenocysteine In all three domains of life (bacteria, eukaryotes, archaea) Encoded by UGA followed by a special hairpin structure (SECIS) without this hairpin UGA is a stop-codon several genes for selenoproteins per genome (or none) corresponds to cysteine in homologs (more efficient in enzymes) Complicated mechanism of incorporation (specific tRNA, seryl-tRNA-synthetase, conversion to SeCys on tRNA, specific elongation factor)
Alignment of SECIS elements
The consensus SECIS structure
SECIS elements: examples
In methanogenic archaea A derivative of lysine Pyrrolysine In methanogenic archaea A derivative of lysine Directly encoded (unlike selenocysteine). Standard mechanism: UAG codon specific tRNA aminoacyl-tRNA UAG rarely used as a stop codon never as the only stop of a gene
Thanks Wikipedia Ergito Authors of papers, photographs and Internet resources Professor Leong Hon Wai The organizers The assistants The students