12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

Slides:

Advertisements

Similar presentations

Chapter 17.5 Gene expression and Mutations

Advertisements

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

DNA Mutations Biology 6(E).

12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

DNA, Mutations and Hazardous Waste. Prokaryote Cell.

Mutations 13.3.

Definition : Any change in the nucleotide sequence of DNA.

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

Gene Mutations Chapter 11.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)

Point Mutations Silent Missense Nonsense Frameshift.

Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.

Regents Biology Mutations Changes to DNA.

Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

CH Mutations in Genes Objectives: 1.Describe the following types of mutations: a.Base substitution b.Base insertion or deletion 2. Explain what can.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

Genetics. Mutations of Genes Mutation – change in the nucleotide base sequence of a genome; rare Not all mutations change the phenotype Two classes of.

1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.

Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.

 BUILD-A-BUG ACTIVITY  Build your bug and turn in to your box  Mutations Notes  Mutations practice QUIZ NEXT CLASS: Transcription and Translation TUESDAY.

Protein synthesis continued.  Transcription is step 1  DNA  mRNA  Nucleus  RNA polymerase.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

Regents Biology Mutations Changes to DNA.

Don’t let this happen to you!!

Gene Mutations.

Gene Mutations.

Gene Mutations Chapter 11.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Human Genetic Mutations

Types of point mutations

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Mutations changes in the DNA sequence that can be inherited

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Mutations. Mutations Let’s quickly review from last class… Two major types of mutations: gene mutations and chromosomal mutations One we’re focusing.

Mutations Section 12-4.

A mutation is a change in an organism’s DNA.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Gene and Chromosomal Mutations

Draw a conclusion from this graph for both the red and blue line

Mutation, Natural Selection, and Artificial Selection

Mutation Notes.

Section 20.4 Mutations and Genetic Variation

Mutations: Changes in Genes

Gene Mutations.

Presentation transcript:

12.4 Mutations

Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription and translation if you are struggling. From your tables and both translated sequences, what do you think a mutation is? Think About It!

What is a mutation? And what can a mutation do?  A mutation is a permanent change in the DNA sequence of a gene.  Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene.

Mutation Types Point mutations : single nucleotide base changes in a gene's DNA sequence. This type of mutation can change the gene's protein product in the following ways:

3 Types of Point Mutations 1. Missense mutations 2. Nonsense mutations 3. Silent mutations  Ex’s:  Cystic Fibrosis  Neurofibromatosis  Sickle Cell Anemia  Tay-Sachs  Color Blindness

Missense Mutation Result in a single amino acid change within the protein.

Nonsense Mutation -Create a premature “stop signal" (or "stop" codon), causing the protein to be shortened.

Silent Mutation  Do not cause amino acid changes within the protein.

Frameshift Mutations  Change the grouping of nucleotide bases into codons.  This results in a shift of "reading frame" during protein translation.

Insertion Mutation Add a DNA Base

Deletion Mutation Remove a DNA Base

Lactose Tolerance Antibiotic Resistance HIV Immunity Malarial Resistance from Sickle Cell Anemia But… mutations can also be beneficial

Mutagens Carcinogens Radiation UV light Environmental Heavy metals Chemical exposure (VOC’s) Bacteria and Viruses Or they could be induced

The World Health Organization’s International Agency for Research on Cancer (IARC) announced that it has moved UV tanning beds to its highest cancer risk category -- "carcinogenic to humans." The use of tanning beds before age 30 is associated with a 75% increase in melanoma risk. Skin cancer occurs when errors (mutations) form the in the DNA of healthy skin cells. The mutations cause the cells to grow out of control and form a mass of cancer cells Skin Cancer

Lung Cancer Smoking causes 87% of all lung cancer cases. Smokers have approximately one chance in 10 of developing lung cancer over his/her lifetime.

Sickle Cell: Mutating virus: geographic-channel/shows/naked-science/ngc-deadly-mutation/ geographic-channel/shows/naked-science/ngc-deadly-mutation/ Radiation leading to mutations and cancer: Addition and deletion mutations: hill.com/sites/ /student_view0/chapter11/animation_quiz_4.htmlhttp://highered.mcgraw- hill.com/sites/ /student_view0/chapter11/animation_quiz_4.html Videos