15.1 Vis_04 Data Visualization Lecture 15 Information Visualization : Part 3
15.2 Vis_04 Visualizing Web Searches
15.3 Vis_04 Sequence Visualization n Visualizing sequence of bases, or nucleotides, in DNA is a particularly challenging application n Bases are: GCAT Thanks to Netta Cohen for these three slides
15.4 Vis_04 Walking through the Genome n Genome sequence is visualized by walking in north (C), south (G), east (T) and west (A) directions, according to the base that is encountered – Walk is not random, but we dont understand all the rules
15.5 Vis_04 Walking through the Genome in 1D AGCTGCGAGTCGAGTTGGCA… value A,G purines T,C pyrimidines Ui = i Ui
15.6 Vis_04 Focus and Context n A recurring problem in Information Visualization is lack of screen real estate n Challenge has been addressed in some innovative ways n Want to achieve: – Focus: to see detail of immediate interest – Context: to see the overall picture
15.7 Vis_04 Bifocal Display n Probably the first suggestion was the bifocal display of Spence and Apperley – Play Spence bifocal_lens movieSpence bifocal_lens movie
15.8 Vis_04 Bifocal Display n Implemented as an image browser that scales different areas of image in different ways – Chris North, Univ of Maryland
15.9 Vis_04 What is the Bifocal Display Doing? n Transforming the information space to the display space – Visual transfer functions – cf colour transfer functions in scivis Information space Display Space Normal display Information space Display Space Bifocal display context focus
15.10 Vis_04 Developing the Idea n Card, Robinson and McKinlay developed the idea into the Perspective Wall Perspective Wall
15.11 Vis_04 The Perspective Wall 2D layout wrapped around a 3D structure Space utilisation: - detail on centre panel 3x size of equivalent flat wall fitting field of view
15.12 Vis_04 Perspective Wall n Advantages: – User can adjust ratio of detail to context – Smooth animation helps user perceive object constancy – Relationship between detail and context is consistent: objects bend around the corner
15.13 Vis_04 Perspective Wall n In terms of transfer function, the situation is closer to the early Spence movie – Perspective gives smoother transition from focus to context Information space Display Space Perspective Wall context focus
15.14 Vis_04 FishEye Menus n Here is the same idea applied to menus – Ben Bederson, University of Maryland n See also: – com.samuelwan.eidt/fisheyemenu/ FisheyeMenuDemo.html
15.15 Vis_04 Comparison of Menu Styles n Research pages at University of Maryland include a nice applet that allows you to compare different menu styles – Arrow bar – Scroll Bar – Hierarchical – FishEye n Screenshots on next slide created from: – hcil/fisheyemenu/ fisheyemenu-demo.shtml hcil/fisheyemenu/
15.16 Vis_04 Menus arrow scroll hierarchical fisheye
15.17 Vis_04 Question n Why is a magnifying glass no good for focus and context?
15.18 Vis_04 Cone Trees n For large tree structures it is impossible to find sufficient screen space n Cone trees provide a solution n Here is a moviemovie animate/conetree.html
15.19 Vis_04 Focus and Context for Volume Visualization n Marcelo Cohen is studying whether we can apply focus + context ideas to volume visualization
15.20 Vis_04 Spence Attribute Explorer n Spence has also developed a tool called Attribute Explorer – Compare it with xmdvtool – Look for brushing concept – Here is the moviemovie
15.21 Vis_04 RSVP n Recent Spence work addresses problem of browsing information spaces – Rapid Serial Visual Processing – To gain a quick view of what is available – Distinction between browsing and searching – Here is the moviemovie
15.22 Vis_04 Browsing the Web n Spence has also turned his attention to browsing the web – On mobile devices! – Here is the moviemovie
15.23 Vis_04 Acknowledgements n The movies were taken from Bob Spences Web Site at Imperial College