© 2010 Pearson Education, Inc. Lectures by Chris C. Romero, updated by Edward J. Zalisko PowerPoint ® Lectures for Campbell Essential Biology, Fourth Edition – Eric Simon, Jane Reece, and Jean Dickey Campbell Essential Biology with Physiology, Third Edition – Eric Simon, Jane Reece, and Jean Dickey Chapter 10 The Structure and Function of DNA

© 2010 Pearson Education, Inc. DNA: STRUCTURE AND REPLICATION DNA: –Was known to be a chemical in cells by the end of the nineteenth century –Has the capacity to store genetic information –Can be copied and passed from generation to generation DNA and RNA are nucleic acids. –They consist of chemical units called nucleotides. –The nucleotides are joined by a sugar-phosphate backbone.

DNA nucleotide Thymine (T) Sugar (deoxyribose) Phosphate group Nitrogenous base (can be A, G, C, or T) Figure 10.1b

Sugar-phosphate backbone Phosphate group Nitrogenous base DNA nucleotide Nucleotide Thymine (T) Sugar Polynucleotide DNA double helix Sugar (deoxyribose) Phosphate group Nitrogenous base (can be A, G, C, or T) Figure 10.1

© 2010 Pearson Education, Inc. Watson and Crick’s Discovery of the Double Helix 1952 James Watson and Francis Crick determined that DNA is a double helix.

© 2010 Pearson Education, Inc. Watson and Crick used X-ray crystallography data to reveal the basic shape of DNA. –Rosalind Franklin collected the X-ray crystallography data.

© 2010 Pearson Education, Inc. The four nucleotides found in DNA differ in their nitrogenous bases. These bases are: –Thymine (T) –Cytosine (C) –Adenine (A) –Guanine (G) RNA has uracil (U) in place of thymine. At The Grand Canyon All Teachers Go Crazy

© 2010 Pearson Education, Inc. The model of DNA is like a rope ladder twisted into a spiral. –The ropes at the sides represent the sugar-phosphate backbones. –Each wooden rung represents a pair of bases connected by hydrogen bonds. DNA bases pair in a complementary fashion: –Adenine (A) pairs with thymine (T) –Cytosine (C) pairs with guanine (G)

Twist Figure 10.4

(c) Computer model (b) Atomic model (a) Ribbon model Hydrogen bond Figure 10.5

© 2010 Pearson Education, Inc. How are DNA and RNA different?

© 2010 Pearson Education, Inc. Comparison of DNA & RNA  DNA  Double strand  Contains A, T, G, C  Only in nucleus  Sugar is De-Oxyribose  RNA  Single strand  Contains A, U, G, C  Goes from nucleus to ribosome  Sugar is Ribose

© 2010 Pearson Education, Inc. DNA Replication When a cell reproduces, a complete copy of the DNA must pass from one generation to the next. Watson and Crick’s model for DNA suggested that DNA replicates by a template mechanism.

Parental (old) DNA molecule Daughter (new) strand Daughter DNA molecules (double helices) Figure 10.6

Origin of replication Origin of replication Origin of replication Parental strands Parental strand Daughter strand Two daughter DNA molecules Bubble Figure 10.7

THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN DNA functions as the inherited directions for a cell or organism. How are these directions carried out? What is the language of nucleic acids? –In DNA, it is the linear sequence of nucleotide bases. –A typical gene consists of thousands of nucleotides. –A single DNA molecule may contain thousands of genes. © 2010 Pearson Education, Inc.

How an Organism’s Genotype Determines Its Phenotype An organism’s genotype is its genetic makeup, the sequence of nucleotide bases in DNA. The phenotype is the organism’s physical traits, which arise from the actions of a wide variety of proteins. © 2010 Pearson Education, Inc.

DNA = genes = traits DNA = code for Protein Synthesis The function of a gene is to dictate the production of a polypeptide. A protein may consist of two or more different polypeptides.

© 2010 Pearson Education, Inc. DNA specifies the synthesis of proteins in two stages: –Transcription, the transfer of genetic information from DNA into an RNA molecule (copy and transfer) –Translation, the transfer of information from RNA into a protein (translate) Protein Synthesis

DNA Cytoplasm Nucleus Figure

RNA TRANSCRIPTION DNA Cytoplasm Nucleus Figure

TRANSLATION Protein RNA TRANSCRIPTION DNA Cytoplasm Nucleus Figure

© 2010 Pearson Education, Inc. What are the rules for translating the RNA message into a polypeptide? A codon is a triplet of bases, which codes for one amino acid.

© 2010 Pearson Education, Inc. Of the 64 triplets (codons) : –61 code for amino acids –3 are stop codons, indicating the end of a polypeptide

© 2010 Pearson Education, Inc.

TRANSLATION Amino acid RNA TRANSCRIPTION DNA strand Polypeptide Codon Gene 1 Gene 3 Gene 2 DNA molecule Figure 10.10

Second base of RNA codon First base of RNA codon Phenylalanine (Phe) Leucine (Leu) Cysteine (Cys) Leucine (Leu) Isoleucine (Ile) Valine (Val) Met or start Serine (Ser) Proline (Pro) Threonine (Thr) Tyrosine (Tyr) Histidine (His) Glutamine (Gln) Asparagine (Asn) Alanine (Ala) Stop Glutamic acid (Glu) Aspartic acid (Asp) Lysine (Lys) Arginine (Arg) Tryptophan (Trp) Arginine (Arg) Serine (Ser) Glycine (Gly) Third base of RNA codon Figure 10.11

© 2010 Pearson Education, Inc.

Transcription: From DNA to RNA Transcription: –Makes RNA from a DNA template –Uses a process that resembles DNA replication –Substitutes uracil (U) for thymine (T)

© 2010 Pearson Education, Inc. Initiation of Transcription The “start transcribing” signal is a nucleotide sequence called a promoter. The first phase of transcription is initiation, in which: –RNA polymerase attaches to the promoter –RNA synthesis begins

© 2010 Pearson Education, Inc. Second base of RNA codon First base of RNA codon Phenylalanine (Phe) Leucine (Leu) Cysteine (Cys) Leucine (Leu) Isoleucine (Ile) Valine (Val) Met or start Serine (Ser) Proline (Pro) Threonine (Thr) Tyrosine (Tyr) Histidine (His) Glutamine (Gln) Asparagine (Asn) Alanine (Ala) Stop Glutamic acid (Glu) Aspartic acid (Asp) Lysine (Lys) Arginine (Arg) Tryptophan (Trp) Arginine (Arg) Serine (Ser) Glycine (Gly) Third base of RNA codon Figure 10.11

© 2010 Pearson Education, Inc. Termination of Transcription During the third phase of transcription, called termination: –RNA polymerase reaches a sequence of DNA bases called a terminator –Polymerase detaches from the RNA –The DNA strands rejoin

© 2010 Pearson Education, Inc. Second base of RNA codon First base of RNA codon Phenylalanine (Phe) Leucine (Leu) Cysteine (Cys) Leucine (Leu) Isoleucine (Ile) Valine (Val) Met or start Serine (Ser) Proline (Pro) Threonine (Thr) Tyrosine (Tyr) Histidine (His) Glutamine (Gln) Asparagine (Asn) Alanine (Ala) Stop Glutamic acid (Glu) Aspartic acid (Asp) Lysine (Lys) Arginine (Arg) Tryptophan (Trp) Arginine (Arg) Serine (Ser) Glycine (Gly) Third base of RNA codon Figure 10.11

© 2010 Pearson Education, Inc. Transfer RNA (tRNA) Transfer RNA (tRNA): –Acts as a molecular interpreter –Carries amino acids –Matches amino acids with codons in mRNA using anticodons

TRANSLATION Amino acid RNA TRANSCRIPTION DNA strand Polypeptide Codon Figure 10.10

© 2010 Pearson Education, Inc. Ribosomes Ribosomes are organelles that: –Coordinate the functions of mRNA and tRNA –Are made of two protein subunits –Contain ribosomal RNA (rRNA)

Polypeptide TRANSLATION TRANSCRIPTION mRNA DNA Gene Figure 10.UN5

Newly made RNA RNA nucleotides RNA polymerase Template strand of DNA Direction of transcription (a) A close-up view of transcription Figure 10.13a

Start of genetic message Tail End Cap Figure 10.17

tRNA polynucleotide (ribbon model) RNA polynucleotide chain Anticodon Hydrogen bond Amino acid attachment site tRNA (simplified representation) Figure 10.15

Next amino acid to be added to polypeptide Growing polypeptide tRNA mRNA Codons (b) The “players” of translation Figure 10.16b

Figure mRNA P site Polypeptide ELONGATION Codon recognition A site Codons Anticodon Amino acid

New peptide bond mRNA movement mRNA P site Translocation Peptide bond formation Polypeptide ELONGATION Codon recognition A site Codons Anticodon Amino acid Figure

New peptide bond Stop codon mRNA movement mRNA P site Translocation Peptide bond formation Polypeptide ELONGATION Codon recognition A site Codons Anticodon Amino acid Figure

© 2010 Pearson Education, Inc.

Protein Synthesis DNA: TTTCAGATCAAATGACCCTCTGTCTAA DNA: _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ mRNA _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ A.A. ____ ____ ____ ____ ____ ____ ____ ____ ____ tRNA _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _

© 2010 Pearson Education, Inc. Second base of RNA codon First base of RNA codon Phenylalanine (Phe) Leucine (Leu) Cysteine (Cys) Leucine (Leu) Isoleucine (Ile) Valine (Val) Met or start Serine (Ser) Proline (Pro) Threonine (Thr) Tyrosine (Tyr) Histidine (His) Glutamine (Gln) Asparagine (Asn) Alanine (Ala) Stop Glutamic acid (Glu) Aspartic acid (Asp) Lysine (Lys) Arginine (Arg) Tryptophan (Trp) Arginine (Arg) Serine (Ser) Glycine (Gly) Third base of RNA codon Figure 10.11

© 2010 Pearson Education, Inc. In a DNA double helix, adenine pairs with ______ and guanine pairs with ______. A) cytosine... thymine B) guanine... adenine C) uracil... cytosine D) thymine... cytosine E) cytosine... uracil

© 2010 Pearson Education, Inc. In a DNA double helix, adenine pairs with ______ and guanine pairs with ______. A) cytosine... thymine B) guanine... adenine C) uracil... cytosine D) thymine... cytosine E) cytosine... uracil

© 2010 Pearson Education, Inc. RNA contains the nitrogenous base ______ instead of ______, which is only found in DNA. A) a deoxyribose sugar... a ribose sugar B) nucleotides... nucleic acids C) uracil... thymine D) cytosine... guanine E) adenine... guanine

© 2010 Pearson Education, Inc. RNA contains the nitrogenous base ______ instead of ______, which is only found in DNA. A) a deoxyribose sugar... a ribose sugar B) nucleotides... nucleic acids C) uracil... thymine D) cytosine... guanine E) adenine... guanine

© 2010 Pearson Education, Inc. If one strand of a DNA double helix has the sequence GTCCAT, what is the sequence of the other strand? A) ACTTGC B) TGAACG C) CAGGTA D) CAGGUA E) CUGGTU

© 2010 Pearson Education, Inc. If one strand of a DNA double helix has the sequence GTCCAT, what is the sequence of the other strand? A) ACTTGC B) TGAACG C) CAGGTA D) CAGGUA E) CUGGTU

© 2010 Pearson Education, Inc. What name is given to the collection of traits exhibited by an organism? A) holotype B) genotype C) typology D) phenotype E) morphology

© 2010 Pearson Education, Inc. What name is given to the collection of traits exhibited by an organism? A) holotype B) genotype C) typology D) phenotype E) morphology

© 2010 Pearson Education, Inc. How many nucleotides make up a codon? A) one B) two C) three D) four E) five

© 2010 Pearson Education, Inc. How many nucleotides make up a codon? A) one B) two C) three D) four E) five

© 2010 Pearson Education, Inc. Transcription is the ______. A) manufacture of a strand of RNA complementary to a strand of DNA B) manufacture of two new DNA double helices that are identical to an old DNA double helix C) modification of a strand of RNA prior to the manufacture of a protein D) manufacture of a protein based on information carried by RNA E) manufacture of a new strand of DNA complementary to an old strand of DNA

© 2010 Pearson Education, Inc. Transcription is the ______. A) manufacture of a strand of RNA complementary to a strand of DNA B) manufacture of two new DNA double helices that are identical to an old DNA double helix C) modification of a strand of RNA prior to the manufacture of a protein D) manufacture of a protein based on information carried by RNA E) manufacture of a new strand of DNA complementary to an old strand of DNA