Notes: Pages 6 & 7
1. 5-Carbon Sugar called DEOXYRIBOSE 2. Phosphate Group 3. Nitrogen Base (A, T, C, or G)
A. Adeneine (A) B. Cytosine (C) C. Guanine (G) D. Thymine (T)
ADENINECYTOSINE GUANINETHYMINE In a DNA molecule: Adenine always pairs with THYMINE Cytosine always pairs with GUANINE Thymine always pairs with ADENINE Guanine always pairs with CYTOSINE
A nucleotide is the BASIC UNIT of structure of a nucleic acid, such as DNA. It consists of a 5-carbon sugar, a phosphate group, and a nitrogen base.
Double Helix It is often called the WATSON-CRICK Model of DNA, named after two of the scientists that first described its structure.
ATTGCTAACCTAACGATTGG GGCCTTAAGCCCGGAATTCG NOTE: In reality, the strands would be lined up NEXT to each other like this:
The process by which a DNA molecule makes an EXACT copy of itself - Base pairs are held together by HYDROGEN BONDS - Before copying begins the DNA molecule UNTWISTS & “UNZIPS” - Bases of free nucleotides in the nucleus form the COMPLIMENTARY strands
DNA UNTWISTS DNA “UNZIPS” COMPLEMENTARY STRANDS FORM