DNA By Alessandro Del fabbro
Structure of a Nucleotide The nucleotide has some key parts which includes, phosphate which has a negative charge, a deoxyribose sugar, and it has all the four bases. Adenine, guanine= Purines Thymine, Cytosine = Pyrimidines That type of base pairing is called complementary base pairing. The DNA strands face the opposite direction. That is called anti parallel.
How nucleotides are arranged in DNA molecules. Adenine is always paired with thymine through a 2 hydrogen bond. Guanine is always paired with cytosine through a 3 hydrogen bond. Adenine and guanine are both purines Cytosine and thymine are both pyrimidines This is called complementary base pairing Deoxyribose is the sugar which is found in DNA. DNA is made up of nucleotides.
What is a Gene? A gene is something passed down from the parents on to their offspring. Yy=Homozygous Recessive when you have two recessive alleles. YY=Homozygous Dominant when you have two dominant alleles. Yy=Heterozygous=when you have two different alleles. Example: You have a YY right handed father, and a yy left handed father. The offspring would have 50% chance of green eyes and 50% chance of brown eyes. You have 50% chance because, there are 2 big YY and 2 small yy its 50 % that there son will be right handed. A gene is a part of the DNA that code for a protein. The base acts like letters that make instruction on how to make protein. The rule is 3 bases stand for amino acid. Amino acid are the building blocks of proteins.
How do ribosome's effect DNA The bases of DNA has all of the instructions so that the ribosome's can make protein. The ribosome's make protein like the RNA goes to a ribosome in the cytoplasm. The ribosome's attach each other to the messenger RNA, but there are two types of RNA. Transfer RNA comes and attaches itself to the messenger which is RNA. Overall this is called protein synthesis.
How is the Genetic Code Used? Step 1 break words into 3 letters (TAC) Step 2 first letter of the 3 letter word is your start spot in the diagram to the left. start in the middle and move outward (TAC) you will start with T in the middle. Step 3 There are lines breaking the circle in four. Since we have the letter T we take the fourth with (T). Step 4 You need to spell the word TAC so from the T that you have you must go to the A. Then you must go to the C which is next to the TRYOSINE. TACGGCGTTAGACAAGTGCGTGAGTACACA
How is DNA Copied? The fist step is the enzyme separates the helix. Once they have done its job to separate the enzyme copies the separated strands. After that the steps of DNA copying is completed.
Ribosomes Ribosomes are the organelles where protein is made Ribosomes use copied DNA called RNA to make protein. RNA tells ribosomes when to make the protein. DNA is the boss and the ribosome's are the builders