Figure 1S. BSR homology. Exhaustive pairwise alignment using neighbour-joining phylogeny analysis by Clone Manager7 software shows the high homology of.

Slides:

Advertisements

Similar presentations

Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.

Advertisements

A Novel Third Isoform of Zebrafish Cytochrome Oxidase IV Brandon Smith Dr. Nancy Bachman, Faculty Advisor.

Applications of protomic Presented By: Muhammad Rizwan Roll no: Department of Bioinformatics.

Proteomics Informatics – Protein identification II: search engines and protein sequence databases (Week 5)

Mass Spectrometry. What are mass spectrometers? They are analytical tools used to measure the molecular weight of a sample. Accuracy – 0.01 % of the total.

MCB 7200: Molecular Biology

Proteomics Informatics (BMSC-GA 4437) Course Director David Fenyö Contact information

My contact details and information about submitting samples for MS

Protein Sequence Analysis - Overview Raja Mazumder Senior Protein Scientist, PIR Assistant Professor, Department of Biochemistry and Molecular Biology.

Proteomics Informatics (BMSC-GA 4437) Course Director David Fenyö Contact information

DEMO CSE fall. What is GeneMANIA GeneMANIA finds other genes that are related to a set of input genes, using a very large set of functional.

Presented by Karen Xu. Introduction Cancer is commonly referred to as the “disease of the genes” Cancer may be favored by genetic predisposition, but.

Identification of regulatory proteins from human cells using 2D-GE and LC-MS/MS Victor Paromov Christian Muenyi William L. Stone.

PROTEIN STRUCTURE NAME: ANUSHA. INTRODUCTION Frederick Sanger was awarded his first Nobel Prize for determining the amino acid sequence of insulin, the.

Towards the Management of Information Quality in Proteomics David Stead University of Aberdeen.

DNA Technology Chapter 20.

Technological Solutions. In 1977 Sanger et al. were able to work out the complete nucleotide sequence in a virus – (Phage 0X174) This breakthrough allowed.

Discover the UniProt Blast tool. Murcia, February, 2011Protein Sequence Databases Customize the BLAST results.

Top-down characterization of proteins in bacteria with unsequenced genomes Nathan Edwards Georgetown University Medical Center.

Finish up array applications Move on to proteomics Protein microarrays.

Common parameters At the beginning one need to set up the parameters.

NIS - BIOLOGY Lecture 57 – Lecture 58 DNA Technology Ozgur Unal 1.

Analysis of Complex Proteomic Datasets Using Scaffold Free Scaffold Viewer can be downloaded at:

Laxman Yetukuri T : Modeling of Proteomics Data

Discovering the Correlation Between Evolutionary Genomics and Protein-Protein Interaction Rezaul Kabir and Brett Thompson

Lecture 9. Functional Genomics at the Protein Level: Proteomics.

C. Other Enzymes PCA1 PCA2 glycolytic HSPB2 CK Other Enzymes PCA1 PCA2 Other Enzymes PC1 glycolytic HSPB2 CK glycolytic HSPB2 CK Quantitation of Changes.

In-Gel Digestion Why In-Gel Digest?

Genomics II: The Proteome Using high-throughput methods to identify proteins and to understand their function.

Proteomics What is it? How is it done? Are there different kinds? Why would you want to do it (what can it tell you)?

Bioinformatics MEDC601 Lecture by Brad Windle Ph# Office: Massey Cancer Center, Goodwin Labs Room 319 Web site for lecture:

Anti-Importin  3 NIH3T3 cells Primary hippocampal neurons Mouse ES cells Anti-Importin  1 Anti-Importin  1 NIH3T3 cells Primary hippocampal neurons.

KEY CONCEPT Biotechnology relies on cutting DNA at specific places.

Bioinformatics and Computational Biology

CSE182 CSE182-L11 Protein sequencing and Mass Spectrometry.

EBI is an Outstation of the European Molecular Biology Laboratory. UniProtKB Sandra Orchard.

Supplementary Figure 1: Comparison of the results obtained from three widely used databases (namely AmiGO, ArrayExpress and GeneCards) with that from HypoxiaDB.

Figure S1 Figure S1. Effect of MeJA on spore germination of M. oryzae. The data presented were the means (± standard error) of spore germination from three.

Proteomics Informatics (BMSC-GA 4437) Instructor David Fenyö Contact information

V diagonal lines give equivalent residues ILS TRIVHVNSILPSTN V I L S T R I V I L P E F S T Sequence A Sequence B Dot Plots, Path Matrices, Score Matrices.

Gene Set Analysis using R and Bioconductor Daniel Gusenleitner

Deducing protein composition from complex protein preparations by MALDI without peptide separation.. TP #419 Kenneth C. Parker SimulTof Corporation, Sudbury,

Protein identification. Peptide Mass Fingerprinting In situ digestion Peptide extraction MALDI-MS Putative Candidates Score 1. Larval serum protein 2.

Using Scaffold OHRI Proteomics Core Facility. This presentation is intended for Core Facility internal training purposes only.

Pathway Informatics 30 th March, 2016 Ansuman Chattopadhyay, PhD Head, Molecular Biology Information Services Health Sciences Library System University.

Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.

Post translational modification n- acetylation Peptide Mass Fingerprinting (PMF) is an analytical technique for identifying unknown protein. Proteins to.

Pathway Informatics 16th August, 2017

Protein identification

Supplementary figure 5.

Statistical Applications in Biology and Genetics

Supplementary Materials

PLANT BIOTECHNOLOGY & GENETIC ENGINEERING (3 CREDIT HOURS)

Forensic Science DNA Analysis

How are areas of DNA that don’t code for proteins (genes) used by our cells? How can we make use of these areas?

Scientists use several techniques to manipulate DNA.

محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)

Proteomics Informatics David Fenyő

High-Resolution Profiling of Histone Methylations in the Human Genome

The future of protein secondary structure prediction accuracy

Adam C Bell, Adam G West, Gary Felsenfeld Cell

A Call for Systematic Research on Solute Carriers

A, high resolution MS/MS spectrum (lower panel) of 1435

Comparative Proteomic Profiling of Murine Skin

Regulation of α-Synuclein Expression by Poly (ADP Ribose) Polymerase-1 (PARP-1) Binding to the NACP-Rep1 Polymorphic Site Upstream of the SNCA Gene Ornit.

High-Resolution Profiling of Histone Methylations in the Human Genome

DNA Profiling Vocabulary

Proteomics Informatics David Fenyő

Schematic representation of a transcriptomic evaluation approach.

Presentation transcript:

Figure 1S. BSR homology. Exhaustive pairwise alignment using neighbour-joining phylogeny analysis by Clone Manager7 software shows the high homology of 12 monomers of the β-satellite repeats (BSR) inside the 4qA allele.

Figure 2S. ZNF555 specifically binds the 4qA enhancer (4qAe) from the 4qA allele. (A) Extract Ion Chromatogram (EIC) on daughter ion m/z belongs to parental ion m/z of Zinc finger protein 555 (Q8NEP9). The protein composition between the EMSA with (experiment) and without (control) 4qAe-oligo was compared. The primary protein bands were excised from the gel, digested with trypsin, and analyzed by NanoLC-ESI-MS/MS for peptide mass fingerprint (PMF). The sequences obtained were screened against the SWISS-PROT database using the MASCOT search engine. The searches were carried out with a peptide mass accuracy tolerance of 100 ppm for external calibration. (B) NanoLC-ESI-MS/MS spectrums of Heat shock protein 71 kDa. The MRM analysis of m/z (2+) of HSP71 (P11142) in control (Ct) and in experiment samples (shifted to 4qAe enhancer).

Figure 3S. Analysis of ZNF555 RNA expression under different pathologies showed the highest score for musculoskeletal and connective tissue diseases. Data were extracted from Disease Atlas ( Disease Atlas ranks diseases, traits, conditions, and surrogate endpoints associated with a gene. Results are grouped by disease and ranked according to statistical significance. The Illumina (Illumina acquired NB) NextBio analysis tool was used to analyze ZNF555 at different pathologies. NextBio is a curated and correlated repository of experimental data derived from an extensive set of public sources (e.g., ArrayExpress and GEO) that allows the user to compare patterns of gene expression between thousands of genomic signatures derived from published datasets. Statistical analysis is carried out using rank-based enrichment analysis to compute pairwise correlation scores of the uploaded dataset and all studies contained in NextBio. The statistical analysis method used by NextBio is referred to as a ‘‘Running Fischer’’ (51). A numerical score of 100 corresponds to the most significant result for ZNF555 gene expression and the scores of the other results were normalized to the top-ranked result. Query executed on date. All samples were compared with healthy control.51

Figure 4S. ADAM12 is a predicted functional partner of ZNF555. The analysis was performed using to the database of known and predicted protein-protein Interactions (

VectorInsertion FragmentSize, bpChromosome Start/End, +Strand p4qA4qA1464Pirozhkova I et al., PLoS One, 2008 p4qA_1Fr 1564 Un_gl : / p4qA_2Fr 2435 Un_gl : / p4qA_3Fr 3468 Un_gl : / p4qA _4Fr 4=4qAe67 Un_gl : / p4qA _5Fr 5203 Un_gl : / p4qA _6Fr 663 Un_gl : / p4qA _7Fr 7106 Un_gl : / pANT1ANT1 promoter7154q: / pFRG1FRG1 promoter588Petrov A et al., Genome Res, 2008 p4qAe_ANT14qAe ANT1 promoter Un_gl : / q: / p4qAe_FRG14qAe FRG1 promoter Un_gl : / Petrov A et al., Genome Res, 2008 Table 1S. Constructs used in the present study.

Sequence IDForwardReverse ANT1 promoterACCCAAGCATGATATGGTTGACTACTGCTGGAGTG FRG1 promoter GCTTGATATTGTTGGTGAGTGACAACCGACTTCTACAAT FRG2 promoter GTTGTTGTTGAGCCTGG CCTAGAAGGTCACCGAA DUX4 ACGGAGACTCGTTTGGATGGCCCTTCGATTCTGA DUX4c TGGCCCTTCGATTCTGAGTGGAGGTGGTAGGTCTTT 4qAe TCCCCTGTAGGCAGAGACACTGATAACCCAGGTGA ZNF555 CCGCCTGCCCCTAGCGGTCCTGAGCAGAATCCAGCAAAGCCCA ANT1 GCCAGCAAACAGATCAGTGCCCCCTCCAGAAGGAGAGGAA FRG1 GAAACCCGGAAGTGGAACTCTCCTGACAGCCTACGTCTCTG GAPDH ACCACAGTCCATGCCATCACCCAGTGAGCTTCCCGTTCAG Table 2S. List of primers used in the present study.

MWID SwissprotEntry Name 70898P11142Heat shock cognate 71 kDa protein – Homo sapiens 84660P07900Heat shock protein HSP 90-alpha - Homo sapiens A5A3E0ANKRD26-like family C member 1B - Homo sapiens 42911P49903Selenide, water dikinase 1 - Homo sapiens 38170O75436Vacuolar protein sorting-associated protein 26A - Homo sapiens 73063Q8NEP9Zinc finger protein Homo sapiens MWID SwissprotEntry Name 84660,2P07900Heat shock protein HSP Homo sapiens 70898,4P11142Heat shock cognate 71kDa protein - Homo sapiens 51804,8Q02790FK506-binding protein 4 - Homo sapiens 32575,2P06748Nucleophosmin - Homo sapiens 36053,4P04406Glyceraldehyde-3-phosphate dehydrogenase - Homo sapiens ,3A5A3E0ANKRD26-like family C member 1B - Homo Sapiens 94300,5P34932Heat shock 70 kDa protein 4 - Homo sapiens ,4P31327Carbamoyl-phosphate synthase [ammonia], mitochondrial precursor - Homo sapiens 27692,8P30048Thioredoxin-dependent peroxide reductase, mitochondrial precursor - Homo sapiens 50151,9P68363Tubulin alpha-1B chain - Homo sapiens 61055P kDa heat shock protein, mitochondrial precursor - Homo sapiens Table 3S. List of proteins identified by analyzing the specific for 4qAe band (with cold competitor) obtained from DIG-EMSA experiment on TE671 cells. The results presented in this table were obtained by NanoLC-ESI-MS/MS for peptide mass fingerprint (PMF). The gray highlighted proteins were detected only in experimental samples. Supplementary Table 4S. List of proteins identified by analyzing the control (Ctl) band without DNA obtained from DIG-EMSA experiment on TE671 cells. The results presented in this table were obtained by NanoLC-ESI-MS/MS for peptide mass fingerprint (PMF).