Copyright © 2014 Elsevier Inc. All rights reserved Chapter 2. Subcellular Organization of the Nervous System: Organelles and Their Functions.

Slides:



Advertisements
Similar presentations
Intracellular Trafficking
Advertisements

Lysosome Nucleus ER Plasma Membrane Mitochondria Golgi.
Lesson 3: Translation.
Protein Sorting & Transport Paths of Protein Trafficking Nuclear Protein Transport Mitochondrial & Chloroplast Transport Experimental Systems Overview.
Intracellular Compartments and Protein Sorting
Unit 7 Endomembranes. SECRETORY PATHWAY: Unit 7 Secretory Pathway Proteins are synthesized on the Rough ER. Move via vesicles to Golgi Move via vesicles.
Javad Jamshidi Fasa University of Medical Sciences Proteins Into membranes and Organelles and Vesicular Traffic Moving.
Cell Structure and Function Chapter 3 Basic Characteristics of Cells Smallest living subdivision of the human body Diverse in structure and function.
Copyright © 2007 Wolters Kluwer Health | Lippincott Williams & Wilkins Neuroscience: Exploring the Brain, 3e Chapter 2: Neurons and Glia.
Lecture 18: Intracellular transport Flint et al., Chapter 12.
Protein Sorting ISAT 351, Spring 2004 College of Integrated Science and Technology James Madison University.
Molecular mechanism of vesicular transport Vesicular pathway--Budding and fusion 1.Budding— how are vesicles formed? How can cargo proteins be selectively.
Lecture 16 Vesicle transport and targeting in the secretory pathway
Major Constituents of Cell
Copyright (c) by W. H. Freeman and Company Chapter 18 Cell Motility and Shape I: Microfilaments.
Topic 41 4.Structure/Function of the Organelles - Synthesis.
Lecture 6 - Intracellular compartments and transport I.
Lecture 7 - Intracellular compartments and transport II
Lecture 3 Vesicular Trafficking -Cops and Clathrins -Arfs, Rabs, Sars -Snares.
Protein synthesis decodes the information in messenger RNA
Protein trafficking between membranes By Graham Warren & Ira Mellman
Endoplasmic Reticulum
Lecture 2: Protein sorting (endoplasmic reticulum) Dr. Mamoun Ahram Faculty of Medicine Second year, Second semester, Principles of Genetics.
Extra credit for Midterm 2
Chapter 25 Protein trafficking Introduction 25.2 Oligosaccharides are added to proteins in the ER and Golgi 25.3 The Golgi stacks are polarized.
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting How are proteins targeted and delivered?
The Secretory Pathway Becky Dutch Molecular and Cellular Biochemistry 1. ER - translation 2. ER- protein modifications 3. Discussion Section 4. Golgi apparatus.
Chapter 2: Neurons and Glia
Previously Bio308 Hypotheses for molecular basis of bipolar disorder Suggest problem lies in protein targeting Proteins made in cytosol (cytosolic and.
Chapter 3 Membrane targeting of proteins By D. Thomas Rutkowski & Vishwanath R. Lingappa.
Copyright © 2014 Elsevier Inc. All rights reserved.
The Function & Anatomy of Neurons What is a Neuron?  It is the cell of nerve tissue that is responsive and conducts impulses within the Nervous System.
Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.
Pages Molecular Motors. General Characteristics of Molecular Motors Motor proteins – bind to a polarized cytoskeletal filament and use the energy.
PROTEIN SYNTHESIS. Protein Synthesis: overview  DNA is the code that controls everything in your body In order for DNA to work the code that it contains.
Slide 1 Neuroscience: Exploring the Brain, 3rd Ed, Bear, Connors, and Paradiso Copyright © 2007 Lippincott Williams & Wilkins Bear: Neuroscience: Exploring.
Endomembrane System Yasir Waheed NUST Center of Virology & Immunolgy National University of Sciences &Technology.
LECT 20: PROTEIN SYNTHESIS AND TRANSLATIONAL CONTROL High fidelity of protein synthesis from mRNA is essential. Mechanisms controling translation accuracy.
CHAPTER 9 The Cytoskeleton and Cell Motility. Introduction The cytoskeleton is a network of filamentous structures: microtubulues, microfilaments, and.
1 Nerve Cells. 2 Nerve cells Around 100 billion neurons in the brain initially –Adult stage 15 billion Means of communication in the nervous system Excitatory.
INTRODUCTION Unit 8 - Cytoskeleton.
BIO201A Cell Biology Lecture 29 Wednesday 04/04/07.
PREPARED BY HUGH POTTER,Ph.D
Psychology 304: Brain and Behaviour Lecture 10
8.2 Structures and Processes of the Nervous System
1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.
The Synaptic transmission M.Bayat PhD
Copyright (c) by W. H. Freeman and Company 17.3 The rough ER is an extensive interconnected series of flattened sacs Figure
Types of Neurons (Nerve Cells) Cells of the nervous system, called neurons, are specialized to carry electrochemical.
Vesicular Transport Pages The general flow of membrane enclosed material within cells.
Vesicular Trafficking Movement From the ER Through the Golgi.
The Cytoskeleton Functions
Chapter 2 Structure and functions of cells of the nervous system.
Cytoplasmic membranes-1 Unit objective: To understand that materials in cell are shuttled from one part to another via an extensive membrane network.
Lecture 12: The secretory pathway
Chapter 28 Nervous system. NERVOUS SYSTEM STRUCTURE AND FUNCTION © 2012 Pearson Education, Inc.
E NDOMEMBRANOUS S YSTEMS By; Ayesha Shaukat. Functions of Rough ER  Many types of cells secrete proteins produced by ribosomes attached to rough ER.
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
Protein Sorting & Transport
Subcellular compartments that constitute the cellular endomembrane system. The major organelles of the endomembrane system are: the endoplasmic reticulum.
Vesicular transport Dr. med. habil. Kőhidai László Assoc. Professor
Introduction “Neurophilosophy” Glia and Neurons
The Road Taken Cell Volume 100, Issue 1, Pages (January 2000)
Protein Synthesis and Transport within the Cell
structure & function of eukaryotic organelle
Intracellular Compartments and Transport
A Gate Keeper for Axonal Transport
Chapter 7 Inside the Cell Biological Science, Third Edition
Intracellular Signaling
Neuronal Polarity and Trafficking
Presentation transcript:

Copyright © 2014 Elsevier Inc. All rights reserved Chapter 2. Subcellular Organization of the Nervous System: Organelles and Their Functions

Figure 2.1 The “Nissl body” in neurons is an array of cytoplasmic-free polysomal rosettes (boxed) interspersed between rows of rough endoplasmic reticulum (RER) studded with membrane-bound ribosomes. Nascent polypeptide chains emerging from the ribosomal tunnel on the RER are inserted into the lumen (arrow), where they may be processed before transport out of the RER. The relationship between the polypeptide products of these “free” and “bound” polysome populations in the Nissl body, an arrangement that is unique to neurons, is unknown. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.2 Basic elements of neuronal subcellular organization. The neuron consists of a soma, or cell body, in which the nucleus, multiple cytoplasm-filled processes termed dendrites, and the (usually single) axon are placed. The neuron is highly extended in space; one with a cell body of the size shown here might maintain an axon several miles in length! The unique shape of each neuron is the result of a cooperative interplay between plasma membrane components and cytoskeletal elements. Most large neurons in vertebrates are myelinated by oligodendrocytes in the CNS and by Schwann cells in the PNS. The compact wraps of myelin encasing the axon distal to the initial segment permit rapid conduction of the action potential by a process termed saltatory conduction (see Chapter 4). Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.3 The secretory pathway. Transport and sorting of proteins in the secretory pathway occur as they pass through the Golgi before reaching the plasma membrane. Sorting occurs in the cis-Golgi network (CGN), also known as the intermediate compartment, and in the trans-Golgi network (TGN). Proteins exit from the Golgi at the TGN. The default pathway is the direct route to the plasma membrane. Proteins bound for regulated secretion or transport to endosomes are diverted from the default path by means of specific signals. In endocytosis, one population of vesicles is surrounded by a clathrin cage and is destined for late endosomes. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.4 Translocation of proteins across the rough endoplasmic reticulum (RER). Integral membrane and secretory protein synthesis begins with partial synthesis on a free polysome not yet bound to the RER. The N-terminus of the nascent protein emerges and allows a ribonucleoprotein, signal recognition particle (SRP), to bind to the hydrophobic signal sequence and prevent further translation. Translation arrest is relieved once the SRP docks with its receptor at the RER and dissociates from the signal sequence in a GTP-dependent process. Once protein synthesis resumes, translocation occurs through an aqueous pore termed the translocon, which includes the translocating chain associating membrane protein (TRAM). The signal sequence is removed by a signal peptidase in the RER lumen. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.5 A. General mechanisms of vesicle targeting and docking in the ER and Golgi. Assembly of coat proteins (COPs) around budding vesicles is driven by ADP-ribosylation factors (ARFs) in a GTP-dependent fashion. Dissociation of the coat is triggered by hydrolysis of GTP bound to ARF and is stimulated by a GTPase-activating protein (GAP) in the Golgi membrane. The cycle of coat assembly and disassembly can continue when replacement of GDP on ARF by GTP is catalyzed by a guanine nucleotide exchange factor (GEF). Fusion of vesicles with target membrane in the Golgi is regulated by a series of proteins, N-ethyl-maleimide-sensitive factor (NSF), soluble NSF attachment proteins (SNAPs), and SNAP receptors (SNAREs), which together assist vesicle docking with target membrane. SNAREs on vesicles (v-SNAREs) are believed to associate with corresponding t-SNAREs on target membrane. B. Mechanisms of vesicle targeting and docking in the synaptic terminal. The synaptic counterpart of v-SNARE is synaptobrevin (also known as VAMP), and syntaxin corresponds to t-SNARE. SNAP-25 is an accessory protein that binds to syntaxin. Synaptotagmin is believed to be the Ca 2+ sensitive regulatory protein in the complex that binds to syntaxin. Neurexins appear to have a role in conferring Ca 2+ sensitivity to these interactions. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.6 Examples of microtubule motor proteins in the mammalian nervous system. The first microtubule motor identified in nervous tissue was a kinesin 1, but studies in mammalian genomes identified 3 kinesin 1 genes, including a neuron-specific form (kinesin 1A). Motor domains are well conserved in all kinesin superfamily genes, but tail domains are more variable and only show homology within a given gene family (e.g., Kinesin 1A, 1B and 1C). Tail domains appear to be specialized for interaction with various target cargos, such as different membrane-bound organelles. After the sequence of the kinesin heavy chain was established, the presence of additional genes that contained sequences homologous to the motor domain of kinesin was soon recognized. The molecular organization of these various motor proteins is diverse, including monomers (Kinesin 3A), trimers (Kinesin 2), and tetramers (ubiquitous and neuron-specific kinesins). Cytoplasmic dynein may interact with membrane-bound organelles (MBO) and cytoskeletal structures, such as microtubules. Genetic methods have established that there may be >45 kinesin- related genes and 16 dynein heavy chains genes in a single organism. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.7 Examples of myosin motor proteins found in mammalian brain. Myosin heavy chains contain the motor domain, whereas light chains (small dumbbell-shaped structures) regulate motor function. Myosin II was the first molecular motor characterized biochemically from skeletal muscle and brain. Genetic approaches have now defined >15 classes of myosin, many of which are found in brain. Myosin II is a classic two-headed myosin forming thick filaments in nonmuscle cells. Myosin I motors have single motor domains, but may interact with actin microfilaments or membranes. Myosin V has multiple binding sites for calmodulin (dumbbell-shaped structures) that act as light chains bound to the motor domain. Mutations in other classes of myosin have been linked to deafness. Myosins I, II, and V have been detected in growth cones as well as in mature neurons. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.8 Slow axonal transport represents the delivery of cytoskeletal and cytoplasmic constituents to the periphery. Cytoplasmic proteins are synthesized on free polysomes and organized for transport as cytoskeletal elements or macromolecular complexes (1). Microtubules are formed by nucleation at the microtubule-organizing center near the centriolar complex (2) and then released for migration into axons or dendrites. Slow transport appears to be unidirectional with no net retrograde component. Studies suggest that cytoplasmic dynein may move microtubules with their plus ends leading (3). Neurofilaments may move on their own or may hitchhike on microtubules (4). Once cytoplasmic structures reach their destinations, they are degraded by local proteases (5) at a rate that allows either growth (in the case of growth cones) or maintenance of steady-state levels. The different composition and organization of cytoplasmic elements in dendrites suggest that different pathways may be involved in delivery of cytoskeletal and cytoplasmic materials to dendrites (6). In addition, some mRNAs are transported into dendrites, but not into axons. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.9 Fast axonal transport represents transport of membrane-associated materials, having both anterograde and retrograde components. For anterograde transport, most polypeptides are synthesized on membrane-bound polysomes, also known as rough endoplasmic reticulum (1), and then transferred to the Golgi for processing and packaging into specific classes of membrane-bound organelles (2). Proteins following this pathway include both integral membrane proteins and secretory polypeptides in the vesicle lumen. Cytoplasmic peripheral membrane proteins such as kinesins are synthesized on free polysomes. Once vesicles are assembled and appropriate motors associate with them, they move down the axon at a rate of 100–400 mm per day (3). Different membrane structures are delivered to different compartments and may be regulated independently. For example, dense core vesicles and synaptic vesicles are both targeted for presynaptic terminals (4), but release of vesicle contents involves distinct pathways. After vesicles merge with the plasma membrane, their protein constituents are taken up in coated vesicles via the receptor-mediated endocytic pathway and delivered to a sorting compartment (5). After proper sorting into appropriate compartments, membrane proteins are either committed to retrograde axonal transport or recycled (6). Retrograde moving organelles are morphologically and biochemically distinct from anterograde vesicles. These larger vesicles have an average velocity about half that of anterograde transport. The retrograde pathway is an important mechanism for delivery of neurotrophic factors to the cell body. Material delivered by retrograde transport typically fuses with cell body compartments to form mature lysosomes (7), where constituents are recycled or degraded. However, neurotrophic factors and neurotrophic viruses act at the level of the cell body and escape this pathway. Vesicle transport also occurs into dendrites (8), but less is known about this process. Copyright © 2014 Elsevier Inc. All rights reserved

Figure 2.10 Axonal dynamics in a myelinated axon from the peripheral nervous system (PNS). Axons are in a constant flux with many concurrent dynamic processes. This diagram illustrates a few of the many dynamic events occurring at a node of Ranvier in a myelinated axon from the PNS. Axonal transport moves cytoskeletal structures, cytoplasmic proteins, and membrane-bound organelles from the cell body toward the periphery (from right to left). At the same time, other vesicles return to the cell body by retrograde transport (retrograde vesicle). Membrane-bound organelles are moved along microtubules by motor proteins such as the kinesins and cytoplasmic dyneins. Each class of organelles must be directed to the correct functional domain of the neuron. Synaptic vesicles must be delivered to a presynaptic terminal to maintain synaptic transmission. In contrast, organelles containing sodium channels must be targeted specifically to nodes of Ranvier for saltatory conduction to occur. Cytoskeletal transport is illustrated by microtubules (rods in the upper half of the axon) and neurofilaments (bundle of rope-like rods in the lower half of the axon) representing the cytoskeleton. They move in the anterograde direction as discrete elements and are degraded in the distal regions. Microtubules and neurofilaments interact with each other transiently during transport, but their distribution in axonal cross sections suggests that they are not stably cross-linked. In axonal segments without compact myelin, such as the node of Ranvier or following focal demyelination, a net dephosphorylation of neurofilament side arms allows the neurofilaments to pack more densely. Myelination is thought to alter the balance between kinase (K indicates an active kinase; k is an inactive kinase) and phosphatase (P indicates an active phosphatase; p is an inactive phosphatase) activity in the axon. Most kinases and phosphatases have multiple substrates, suggesting a mechanism for targeting vesicle proteins to specific axonal domains. Local changes in the phosphoryation of axonal proteins may alter the binding properties of proteins. The action of synapsin I in squid axoplasm suggests that dephosphorylated synapsin cross-links synaptic vesicles to microfilaments. When a synaptic vesicle encounters the dephosphorylated synapsin and actin-rich matrix of a presynaptic terminal, the vesicle is trapped at the terminal by inhibition of further axonal transport, effectively targeting the synaptic vesicle to a presynaptic terminal. Similarly, a sodium channel-binding protein may be present at nodes of Ranvier in a high-affinity state (i.e., dephosphorylated). Transport vesicles for nodal sodium channels (Na channel vesicle) would be captured upon encountering this domain, effectively targeting sodium channels to the nodal membrane. Interactions between cells could in this manner establish the functional architecture of the neuron. Copyright © 2014 Elsevier Inc. All rights reserved