SC.912.L.14.6.  What factors affect individual and public health?

Slides:

Advertisements

Similar presentations

Mr. Ramos Health and Disease. Introduction to Health & Diseases Health is the state of one’s body. Good health and bad health Disease is anything that.

Advertisements

Practical Applications of Biotechnology 1.Bioprocessing technology  Uses whole living cells or components of them to manufacture desired products.  Most.

Immune System SC.912.L Explain the basic functions of the human immune system, including specific and nonspecific immune response, vaccines, and.

SNC2D. Cell Growth and Repair Cells of different parts of our body will undergo cell growth and mitosis at different rates Skin cells and cells in the.

Congenital and Genetic Disorders Health Science Technology.

Introduction to Human Genetics. Facts Humans have 46 chromosomes or 23 pairs of chromosomes 2 types of chromosomes: –Autosomes: chromosomes that determine.

& Genetic Disorders.  Show the genetic history of a family  “Genetic Family Tree“  Shows phenotypes one generation to the next  Sometimes shows genotypes.

What is a mutation? A mutation is a permanent change in the sequence of DNA.

Pathogens Cause Disease. Being Sick Can Really Get Ya!

4. Health issues for Australia’s youth. Youth health issues in Australia Many factors influence the health and individual human development of youth Generally,

PUBLIC HEALTH TRENDS Michael R. Spence, MD, MPH Medical Officer Montana DPHHS.

Caring for Children With Special Medical Conditions

Chronic Illnesses Common Chronic Illnesses in the Classroom.

Jeopardy Opening Game Board $ 200 $ 200 $ 200 $ 200 $ 200 $ 400 $ 400 $ 400 $ 400 $ 400 $ 10 0 $ 10 0 $ 10 0 $ 10 0 $ 10 0 $ 300 $ 300 $ 300 $ 300 $

Unit 5 – Public Health Chronic Diseases

Biological Hazards Epidemiology – the study of factors affecting the health and illness of a population Dose Response Curve – not caused by living organisms.

 All the external conditions, circumstances, and influences surrounding and affecting the growth and development of an organism or a community of organisms.

Diseases that are not spread by pathogens, but instead by heredity, birth, lifestyle or the environment. These diseases are often called chronic and degenerative:

Pathogens Mr. Mah Living Environment Lecture 11. Warm-Up Take 3 minutes to write down as many diseases/illnesses you can think of! Now, put a dot beside.

Gene Mutations. What are mutations and where do they occur?

By: Diana Olalde (DNA Mutations).  DNA is constantly subject to mutations, accidental changes in its code. Mutations can lead to missing or malformed.

Key Concepts  Types of hazards people face  Methods of toxicology  Types and measurement of chemical hazards  Types and effects of biological hazards.

Mutations. WHAT?..... DO YOU SEE- WHAT HE SEES?

 PPM –  PPB –  PPT – Parts per million (1 in per 1,000,000, ) Parts per billion (1 part in 1,000,000,000, ) Parts per trillion (1 in 1,000,000,000,000,

Infectious/Non-Infectious Disease Infectious Disease (Ch. 21) –A disease caused by organisms- such as bacteria, viruses, fungi or parasite. Many live in.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

What’s the Difference? Genetic and Common Diseases.

Life Span &Life Expectancy Done: by Deidre Brown.

Cat1 Cat2Cat3Cat4 Potpourri.

Spread of Diseases Essential Question: How do microbes affect the spread of diseases?

Reducing Health Risks 6/13/ Effective ways to reduce the risks from other factors Take action to avoid or reduce known risks Obtain regular check-ups.

Bryan Valle Period 2. Basic functions of the human immune system  The human immune system is made up of several interdependent cell types which protect.

Environmental Health. What is Environmental Health? Refers to the influence of environmental conditions on the development of disease or injury.

©2012 Cengage Learning. All Rights Reserved. Chapter 4 Common Chronic Medical Conditions Affecting Children’s Health.

Risk, Toxicology & Human Health Chapter 10. I. Risk A.The probability of hazard (injury, disease, economic or environmental damage B. Risk Assessment.

Human Disease The beginning of health is to know the disease. Cervantes.

Health and the Human Body Anatomy & Physiology 2015.

Practical Applications of Biotechnology

13.2 – Human Genetic Disorders

Practical Applications of Biotechnology

Noncommunicable Diseases

Introduction to Diseases

Counting Disease: Worldwide Importance of Certain Diseases

DEFENSE MECHANISMS IMMUNE RESPONSE CAUSES PATHOGENS

Practical Applications of Biotechnology

Practical Applications of Biotechnology

Practical Applications of Biotechnology

Non-Infectious Diseases and your Health

Gene Mutations.

Infectious Diseases 1.

BTEC Level 2 Applied Science Unit 7: Health Applications of Life Science Diseases.

DISEASE Unit C – Science 24.

Infectious/Non-Infectious Disease

Factors affecting development

The DNA molecule.. Which molecule allows heredity information to be passed from generation to generation?

Family Health History Health project.

Adaptations and Mutations

Pathogens and Disease.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Non-Infectious Diseases and Your Health

Biotechnology is the use of biological systems, such as microorganisms, whole cells or their molecules, to solve problems or to make useful products.

Practical Applications of Biotechnology

Taking Charge of Your Health

Presentation transcript:

SC.912.L.14.6

 What factors affect individual and public health?

Determined by Genes Cystic Fibrosis Colorblindness Down Syndrome Sickle Cell Anemia Influenced by Genes Cancers Alzheimer’s Diabetes Hypertension Asthma Epilepsy

 Although your genes only affect you. The mixture of genes within a population can determine its overall health.

 Health issues are sometimes caused by environmental factors which can include pathogens. These can affect individuals or entire populations. ◦ Air quality  Asbestos, Smog, Mold, Lead, Allergens ◦ Water quality  Chemical waste, Feces, Bacteria, Viruses, Parasites ◦ Food Quality  Malnutrition due to drought and/or poverty  Contaminated Foods

 Public Health also includes issues like violence, and poverty. Make a concept map showing how community violence, family violence or poverty can increase the effects of genetic, environmental, and or pathogenic causes of illness.

 Make a list of health concerns among your friends and family. Then classify the concerns as Genetic, Environmental, Pathogenic.

 Reading in the content area.