Nature, Structure and Organisation of the Genetic Material Chapter 10 Gene Sequencing and DNA repair

DNA How is the sequence of bases (nucleotides) on a piece of DNA determined?

Gene Sequencing Gene sequencing is a process in which the individual nucleotides in an organism's DNA are identified. This technique is used to learn more about the genome of the organism as a whole, and to identify specific areas of interest and concern.

Gene Sequencing Medical researchers are very interested in gene sequencing because the process can be used to identify genetic abnormalities at the base level. Gene sequencing tests are used today to test samples of material from foetuses to check for common genetic conditions and to test samples from parents who are concerned about passing down hereditary diseases to their future children.

Gene Sequencing A T G G T G C A C C T G A C T C C T G A G G A G A A This is part of the nucleotide sequence of the template strand for the human HBB gene which controls the production of one of the protein chains found in haemoglobin. What is the sequence of the complementary DNA strand? What is the mRNA sequence?

DNA Sequencer door open to show inside Scanning laser gel computer display showing results

Gene Sequencing Laser signal gel Computer Output Results from a DNA Sequencer

Gene Sequencing DNA Sequencers are automated. They use four different coloured fluorescent dyes (one for each base). A piece of DNA is heated to 90°C for two minutes breaking the hydrogen bonds between the two strands (dissociation) to form two single chains of DNA. The single chain of template DNA is placed in the sequencer and bases are added one base at a time to match the complementary base (A – T and G – C).

Gene Sequencing DNA template CTCTCCGCCAAACGCATAACC 1st copy G* 2nd copy GA* 3rd copy GAG* 4th copy GAGA* … 21st copy GAGAGGCGGTTTGCGTATTGG*

Gene Sequencing In each case the nucleotide at the end of the sequence is labelled with the fluorescent dye (shown as a ‘*’). The different colours are interpreted by the computer into a series of letters denoting the bases.

Gene Sequencing

Gene Sequencing Old style DNA sequencing gel that used ethidium bromide (etBr) to stain the agarose gel. Then the gel is placed under UV light to make the etBR fluoresce and a X-ray sheet is placed over the top of the gel to be exposed.

Gene Sequencing Gene sequences are used to compare changes and conserved portions of genes between different organisms WEHI Link is to WEHI division of Bioinformatics go to gene sequencing link

What is a Genome? A genome contains all of the biological information needed to build and maintain a living organism. The biological information contained in a genome is encoded in its deoxyribonucleic acid (DNA) and is divided into discrete units called genes.

The Human Genome Project (HGP) Sequencing of the human genome, officially began as the Human Genome Project in 1990. After sequencing of the human genome was largely completed in 2003, the sequence of each chromosome was carefully analysed.

Other sequenced genomes Over 180 genomes have been sequenced since 1995. Some examples of species whose genomes have been sequenced include: Bacillus anthracis – bacteria that causes anthrax Apis mellifera – honeybee Canis familiaris – domesticated dog Chlamydia trachomatis – bacteria that cause chlamydia Drosophila melanogaster – fruit fly

Genetic material and mutations Mutations can be caused by various means including: Radiation Viruses Mutagenic chemicals Errors during meiosis and mitosis The affects of mutations ranges from no affect at all, alter the gene, but not the product to prevent the gene from functioning properly.

DNA Repair Repair of damaged DNA is so important to the survival of an organism, it is no surprise therefore that many different DNA repair enzymes have evolved. Almost 100 are known in E. coli About 130 have been identified in humans so far.