Mapping in Arabidopsis Jeff Long Salk Institute

Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem

WT tpl-1 mutant phenotypes monocot tpl-1 tube tpl-1 pin tpl-1 One way to learn about development is by examining mutants

One way to learn about development is by examining mutants How does one generate mutants? T-DNA mutagenesis Mutagens that create base pair changes EMS, Gamma Rays, Others Problem-How do you identify the mutated gene from the other 25,000 found in the genome?

The answer is by mapping! In Arabidopsis we can take advantage of DNA differences between different strains or ecotypes. What is an ecotype?

An ecotype is just another strain of Arabidopsis that has been geographically isolated

Different ecotypes often contain differences in their DNA These differences can destroy or create new restriction sites Known as restriction fragment length polymorphisms or RFLP’s These RFLP’s can be tracked either by Southern blotting or PCR followed by digestion

promotercoding Sequence differences can be found between ecotypes CCAAGCTGAATTCTTCGAAT Col CCAAGCTGTATTCTTCGAAT Ler EcoR1

Ler Col LerCol LerCol

Ler Col DNA changes can also cause insertions/deletions-Indels Can use PCR primers to track these changes=markers The example below is a simple sequence length polymorphism-SSLP’s

Indels can be tracked by PCR with no digestion

Mapping strategy Cross your mutant to a different ecotype (our case mutant is in Landsberg erecta and different ecotype is Columbia) Allow the F1 population to self after meiosis (where recombination will take place) Isolate DNA from resulting F2 mutant plants- use DNA differences between ecotypes to map

F1 plant F2 gametes

Mutant X different ecotype Self F1 plants Select mutant F2 plants for mapping mutant marker 1 marker 2 F2 chromosomes

mutant marker 1 marker 2 Markers close to your gene will show a bias toward the original ecotype Referred to as linkage Ler Col 9/10 Ler F2 chromosomes By picking homozygous mutants, you know the ecotype at the mutant locus 5/12 Ler LerCol

monocot tpl-1 Isolate DNA from tpl-1 mapping population