Slide 4.1 Lesson 4 How similar or different are cells? Skin cellsBlood cells.

Slides:

Advertisements

Similar presentations

Amanda Barrera Biology Honors Period 1

Advertisements

PACKET 11- DNA TECHNOLOGY. WHAT DO WE ALREADY KNOW ABOUT DNA?  DNA is __________ stranded  DNA is made up of four bases: ____, ____,_____, and _____.

DNA Techniques Lab Preparation 13-1 Manipulating Genes Genetic Engineering: You can repair genes, insert genes, excise genes or replace genes with gene.

Sudden Death and Sickle Cell Trait: How Knowing Your Genes Can Save Your Life Dale Lloyd II, No. 39. (The Rice Football Webletter) 2006 After running 16.

Do Now:. DNA Fingerprinting Everyone (except identical twins) has a unique DNA sequence in their cells. A technique called ________________________can.

Gel Electrophoresis.

Introduction to DNA.

Agarose Gel Electrophoresis 1Dr. Nikhat Siddiqi. Agarose is a linear polymer made up of the basic repeating unit of agarobiose which comprises alternating.

* Technique used to separate samples of DNA, RNA, and protein according to charge and/or size * Smaller molecules move farther and faster through the.

(RFLP Electrophoresis)

Connect!  What is physical therapy?  What is respiratory therapy?  What does “therapy” mean?  So, what do you think “gene therapy” might mean?

Electrophoresis. Means literally to “carry with electricity.” Used to separate charged molecules such as DNA, RNA, & proteins. Larger (heavier) particles.

Unit 8 test Biotech study guide.

Copyright Pearson Prentice Hall

DNA Fingerprinting. We share 99.9% of our DNA with each other. That means the 0.1% of our DNA makes us unique. But that is still is over 3,000,000 differences!

Group of people% people with lactose intolerance Americans of European descent 12% African Americans75% Native Americans100% Mexican Americans 55% English10%

III Manipulating DNA. The Tools of Molecular Biology How do scientists make changes to DNA? The Tools of Molecular Biology.

Slide 2.1 Lesson 2 Special Skin Cells Make Melanin body epidermis How is melanin made inside the melanocytes? epidermis melanocytes tissue cells.

13-1 Changing the Living World

Manipulation of DNA. Restriction enzymes are used to cut DNA into smaller fragments. Different restriction enzymes recognize and cut different DNA sequences.

Comparing DNA Aim: How can we compare organisms using gel electrophoresis? Do Now: Write two observations from your results of gel electrophoresis.

Chapter 19 Organization and Control of Eukaryotic Genomes (here are at least 6 different modes of eukaryotic gene control…) (Remember: the example of operons.

Visualizing DNA. What is it?  Gel electrophoresis is one of the techniques scientists use to look at the DNA they have.  This technique separates DNA.

 DNA can be collected from any living tissue:  blood, skin, hair, urine, semen, sweat or tears.

Overview Amgen Biotech Labs In this set of labs, students will:

Cell Activity Videos Learning Set 2 : Lesson 2 : Slide 1 Optional 1) Plant Cells 2) Mitosis 3) Phagocytosis 4) Listeria 5) Neutrophil 6) Exocytosis 7)

AP Biology DNA Study Guide. Chapter 16 Molecular Basis of Heredity The structure of DNA The major steps to replication The difference between replication,

GEL ELECTROPHORESIS. FIRST, WHAT……  Simply put, gel electrophoresis is a technique used to separate molecules such a DNA, RNA and proteins according.

Chapter 9: Genetic Engineering

Gel Electrophoresis.

(RFLP Electrophoresis)

Biotechnology Intro & Gel Electrophoresis

How many genes do we have/need?

DNA fingerprinting is not taking someone’s fingerprint. It is cutting up a DNA strand and separating them by size.

Gel Electrophoresis.

Biotechnology Intro & Gel Electrophoresis. What does… BIO- mean? TECHNOLOGY? SO….

Unit 2-5 Notes Mr. Hefti – Pulaski Biology Genetic Testing.

DNA Profiling (DNA fingerprinting) pard/cleared.html.

Science Fact of the Day: Hummingbirds can't walk..

Biotechnology Introduction to Micropipettes and Gel Electrophoresis.

Biotechnology Intro & Gel Electrophoresis Test:__________% Test:__________%

Semester 2 Final Review Part 1 Genetics, Biotechnology, Protein Synthesis and Evolution.

Gel Electrophoresis By Erin Martin & Satya Moolani.

Gel Electrophoresis L/O - Describe how gel electrophoresis can be used to separate DNA fragments of different length. 2 3.

DNA marker analysis Mrs. Stewart Medical Interventions Central Magnet School.

Chapter 13-2 & 13-3: Manipulating DNA & Cell Transformation

Biotechnology. Gel Electrophoresis A technique that separates macromolecules on the basis of their rate of movement through a gel under the influence.

DO NOW 1. Get out your Embryos-R-Us HW 2. Detail the decision you made. Why did you make that decision?

Genetic Engineering Chapter 15 in Textbook. Selective Breeding Selective Breeding: allowing only those organisms with desired characteristics to reproduce.

The genetic engineers toolkit A brief overview of some of the techniques commonly used.

Gel Electrophoresis + restriction enzymes Lecturer: Bahiya Osrah.

AGENDA – 12/15/15  Take out journals and pick up only one handout per 2 people! Bell-Ringer: Karyotype DNA Fingerprinting Intro brief notes Who Ate The.

Warmup 4/12/16: Place Unit 6 Vocabulary in folder at your station. Complete Unit 5 Key Review Questions on a separate sheet of paper. Be sure to write.

Unit 11 Lesson 2.

Selective Breeding Limitations of selective breeding and mutations:

PCR and RLFP’s.

Reminders Unit 8 Exam- Tuesday, March, 21st

DNA Technology.

محاضرة عامة التقنيات الحيوية (هندسة الجينات .. مبادئ وتطبيقات)

What Will They Think of Next!!!

Visualizing DNA Gel Electrophoresis.

DNA FINGERPRINTING Gel Electrophoresis

Notepack # 34 AIM: Now that we know a lot about DNA what can we do with this information? Do Now: Answer the following questions: Why is DNA important?

Introduction to Gel Electrophoresis

DNA FINGERPRINTING Gel Electrophoresis

How to fingerprint the bad guy

13.2 – Manipulating DNA.

Presentation transcript:

Slide 4.1 Lesson 4 How similar or different are cells? Skin cellsBlood cells

Slide 4.2 Lesson 4 1) Prepare gel Image from powerful microscope gel Holes for samples to be tested

Slide 4.3 Lesson 4 2) Put protein sample in hole Pipet with solution of proteins Lots of different sized proteins

Slide 4.4 Lesson 4 3) Include all the samples you want to test lactase tyrosinase

Slide 4.5 Lesson 4 4) Provide power to the electrodes Negatively charged proteins move towards positive electrode larger proteins smaller proteins

Slide 4.6 Lesson 4 5a) Proteins separate based on size lactase tyrosinase

Slide 4.7 Lesson 4 5b) Judging the amount of protein A little lactase A lot of lactase

Slide 4.8 Lesson 4 5c) Analyzing RNA Longer RNA Shorter RNA

Slide 4.9 Lesson 4 6) Take a picture to record your work

Slide 4.10 Lesson 4 Lactose intolerance in Jason’s family Lactose intolerance: 1)No (Mom) 2)Yes (Jason) 3)No (Chelsea) 4)No (Maya)

Slide 4.11 Lesson 4 Results: DNA sequence analysis of lactase gene: Mom:no mutations in lactase genes Jason:no mutations in lactase genes Chelsea:no mutations in lactase genes Maya:no mutations in lactase genes

Slide 4.12 Lesson 4 Results: RNA analysis of lactase gene 213 Lactose intolerance: 1)No (Mom) 2)Yes (Jason) 3)No (Chelsea) 4)No (Maya) 4

Slide 4.13 Lesson Lactose intolerance: 1)No (Mom) 2)Yes (Jason) 3)No (Chelsea) 4)No (Maya) Why does Jason have no protein? Why Mom and Chelsea have less protein? Gel electrophoresis: Lactase samples from 4 people 4

Slide 4.14 Lesson 4 Results: DNA sequence of area near the lactase gene Mom: ATTTGC Jason: ATCTGC TAAACGTAGACGATCTGCTAGACG Chelsea: ATCTGC Maya: ATTTGC TAGACGTAAACGATTTGCTAAACG

Slide 4.15 Lesson 4 Erythropoietin (EPO) AGCTTCCCGGGATGAGGGCCC TCGAAGGGCCCTACTCCCGGG environment gene protein cells Small amount of oxygen O-O Lots of oxygen O-O gene “on” some of the timegene “on” most of the time some protein lots of protein some cells lots of cells AGCTTCCCGGGATGAGGGCCC TCGAAGGGCCCTACTCCCGGG