Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Centre for Integrative Bioinformatics VU (IBIVU) Tel. 47649,

Slides:



Advertisements
Similar presentations
Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
Advertisements

DNA DNA. DNA is often called the blueprint of life. In simple terms, DNA contains the instructions for making proteins within the cell. Proteins control.
Nucleic Acid Structure and Function. Function of DNA (DeoxyriboNucleic Acid) Contains sections called “genes” that code for proteins. These genes are.
Bioinformatics What is bioinformatics? Why bioinformatics? The major molecular biology facts Brief history of bioinformatics Typical problems of bioinformatics:
Master Course Sequence Analysis Anton Feenstra, Bart van Houte, Walter Pirovano, Jaap Heringa Tel , Rm.
Collaborative Information Management: Advanced Information Processing in Bioinformatics Joost N. Kok LIACS - Leiden Institute of Advanced Computer Science.
Introduction to Bioinformatics Yana Kortsarts Bob Morris.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Integrative Bioinformatics Institute VU (IBIVU) Tel ,
Bioinformatics Master’s Course Genome Analysis ( Integrative Bioinformatics ) Lecture 1: Introduction Centre for Integrative Bioinformatics VU (IBIVU)
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW C E N T.
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Data-intensive Computing: Case Study Area 1: Bioinformatics B. Ramamurthy 6/17/20151.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa
Master Course Sequence Analysis Anton Feenstra, Bart van Houte, Radek Szklarczyk, Walter Pirovano, Jaap Heringa Tel.
BI420 – Course information Web site: Instructor: Gabor Marth Teaching.
Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.
© Wiley Publishing All Rights Reserved. Biological Sequences.
Meer perspectief Master’s programme in Bioinformatics Bio-tools for the Future International 2-year Bioinformatics Master’s Programme.
Bioinformatics.
How does DNA work? Building the Proteins that your body needs.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Unit 1: DNA and the Genome DNA and the Genome Unit 1: CFE Higher Biology June – October Unit Assessment – before October break.
Master’s course Bioinformatics Data Analysis and Tools Lecture 1: Introduction Centre for Integrative Bioinformatics FEW/FALW
A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.
Introduction to Bioinformatics Spring 2002 Adapted from Irit Orr Course at WIS.
Chapter 11 - DNa introduction. Forensics Uses DNA evidence has been used to investigate crimes, establish paternity, and identify victims of war and large-
Molecular Biology Primer. Starting 19 th century… Cellular biology: Cell as a fundamental building block 1850s+: ``DNA’’ was discovered by Friedrich Miescher.
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
DNA These “genes” never go out of style!! Ms. Kooiman La Serna High School.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
Introduction to Bioinformatics Yana Kortsarts References: An Introduction to Bioinformatics Algorithms bioalgorithms.info.
DNA alphabet DNA is the principal constituent of the genome. It may be regarded as a complex set of instructions for creating an organism. Four different.
Introduction to Genetics: DNA Grades 9-12 Matt Cardinal.
National 5 Biology Course Notes Part 4 : DNA and production of
DNA "The Blueprint of Life". DNA stands for... DeoxyriboNucleic Acid.
CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.
DIALing the IBIVU Vrije Universiteit Amsterdam Jaap Heringa Centre for Integrative Bioinformatics VU (IBIVU) Faculty of Sciences / Faculty of Earth and.
Course Sequence Analysis for Bioinformatics Master’s Bart van Houte, Radek Szklarczyk, Victor Simossis, Jens Kleinjung, Jaap Heringa
California Content Standards
Central dogma: the story of life RNA DNA Protein.
EB3233 Bioinformatics Introduction to Bioinformatics.
© Copyright 2010 Robert D. Conway All Rights Reserved Who Invented It? The Controversial History of Technology and Invention
An overview of Bioinformatics. Cell and Central Dogma.
Bioinformatics and Computational Biology
1 From Mendel to Genomics Historically –Identify or create mutations, follow inheritance –Determine linkage, create maps Now: Genomics –Not just a gene,
DNA "The Blueprint of Life".
Applied Bioinformatics Dr. Jens Allmer Week 1 (Introduction)
Introduction to molecular biology Data Mining Techniques.
BME435 BIOINFORMATICS.
Bioinformatics Overview
Data-intensive Computing: Case Study Area 1: Bioinformatics
DNA Structure.
Protein Synthesis.
Deoxyribonucleic Acid
DNA "The Blueprint of Life".
DNA "The Blueprint of Life".
DNA "The Blueprint of Life".
C E N T R F O I G A V B M S U 2MNW/3I/3AI/3PHAR bachelor course Introduction to Bioinformatics Lecture 1: Introduction Centre for Integrative Bioinformatics.
Genome organization and Bioinformatics
DNA "The Blueprint of Life".
Science 9:Unit A Biological Diversity Lesson DNA
Bioinformatics Vicki & Joe.
Bioinformatics For MNW 2nd Year
Additional info: Genes & DNA
DNA "The Blueprint of Life".
DNA "The Blueprint of Life".
DNA "The Blueprint of Life" DNA stands for... DeoxyriboNucleic Acid.
Presentation transcript:

Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Centre for Integrative Bioinformatics VU (IBIVU) Tel , Rm R4.41

Other teachers in the course Anton Feenstra, Postdoc (1/09/05) Bart van Houte – PhD (1/09/04) Walter Pirovano – PhD (1/09/05) Radek Szklarczyk - PhD (1/01/03)

Bioinformatics course 2nd year MNW spring 2006 Pattern recognition –Supervised/unsupervised learning –Types of data, data normalisation, lacking data –Search image –Similarity/distance measures –Clustering –Principal component analysis

Bioinformatics course 2nd year MNW spring 2006 Protein –Folding –Structure and function –Protein structure prediction –Secondary structure –Tertiary structure –Function –Post-translational modification –Prot.-Prot. Interaction -- Docking algorithm –Molecular dynamics/Monte Carlo

Bioinformatics course 2nd year MNW spring 2006 Sequence analysis –Pairwise alignment –Dynamic programming (NW, SW, shortcuts) –Multiple alignment –Combining information –Database/homology searching (Fasta, Blast, Statistical issues-E/P values)

Bioinformatics course 2nd year MNW spring 2006 Gene structure and gene finding algorithms Genomics –Sequencing projects –Expression data, Nucleus to ribosome, translation, etc. –Proteomics, Metabolomics, Physiomics –Databases DNA, EST Protein sequence (SwissProt) Protein structure (PDB) Microarray data Proteomics Mass spectrometry/NMR/X-ray

Gathering knowledge Anatomy, architecture Dynamics, mechanics Informatics (Cybernetics – Wiener, 1948) (Cybernetics has been defined as the science of control in machines and animals, and hence it applies to technological, animal and environmental systems) Genomics, bioinformatics Rembrandt, 1632 Newton, 1726

Mathematics Statistics Computer Science Informatics Biology Molecular biology Medicine Chemistry Physics Bioinformatics

“Studying informational processes in biological systems” (Hogeweg, early 1970s) No computers necessary Back of envelope OK Applying algorithms with mathematical formalisms in biology (genomics) Not good: biology and biological knowledge is crucial for making meaningful analysis methods! “Information technology applied to the management and analysis of biological data” (Attwood and Parry-Smith)

Bioinformatics in the olden days Close to Molecular Biology: –(Statistical) analysis of protein and nucleotide structure –Protein folding problem –Protein-protein and protein-nucleotide interaction Many essential methods were created early on (BG era) –Protein sequence analysis (pairwise and multiple alignment) –Protein structure prediction (secondary, tertiary structure)

Bioinformatics in the olden days (Cont.) Evolution was studied and methods created –Phylogenetic reconstruction (clustering – e.g., Neighbour Joining (NJ) method)

But then the big bang….

The Human Genome June 2000

Dr. Craig Venter Celera Genomics -- Shotgun method Francis Collins (USA)/Sir John Sulston (UK) Human Genome Project

Human DNA There are at least 3bn (3  10 9 ) nucleotides in the nucleus of almost all of the trillions (3.2  ) of cells of a human body (an exception is, for example, red blood cells which have no nucleus and therefore no DNA) – a total of ~10 22 nucleotides! Many DNA regions code for proteins, and are called genes (1 gene codes for 1 protein as a base rule, but the reality is a lot more complicated) Human DNA contains ~27,000 expressed genes Deoxyribonucleic acid (DNA) comprises 4 different types of nucleotides: adenine (A), thiamine (T), cytosine (C) and guanine (G). These nucleotides are sometimes also called bases

Human DNA (Cont.) All people are different, but the DNA of different people only varies for 0.2% or less. So, only up to 2 letters in 1000 are expected to be different. Evidence in current genomics studies (Single Nucleotide Polymorphisms or SNPs) imply that on average only 1 letter out of 1400 is different between individuals. Over the whole genome, this means that 2 to 3 million letters would differ between individuals. The structure of DNA is the so-called double helix, discovered by Watson and Crick in 1953, where the two helices are cross-linked by A-T and C-G base-pairs (nucleotide pairs – so-called Watson-Crick base pairing).

Modern bioinformatics is closely associated with genomics The aim is to solve the genomics information problem Ultimately, this should lead to biological understanding how all the parts fit (DNA, RNA, proteins, metabolites) and how they interact (gene regulation, gene expression, protein interaction, metabolic pathways, protein signalling, etc.) More in next lectures…

Translational Medicine “From bench to bed side” Genomics data to patient data Integration

TERTIARY STRUCTURE (fold) Genome Expressome Proteome Metabolome Functional Genomics From gene to function