A Knowledge Model for Analysis and Simulation of Signal Transduction Networks.

Slides:

Advertisements

Similar presentations

Annotation of Gene Function …and how thats useful to you.

Advertisements

Modelling Cell Signalling Pathways in PEPA

Statistical methods and tools for integrative analysis of perturbation signatures Mario Medvedovic Laboratory for Statistical Genomics and Systems Biology.

Ontology annotation: mapping genomic regions biological function Paul D Thomas, Huaiyu Mi and Suzanna Lewis.

GOAT: The Gene Ontology Annotation Tool Dr. Mike Bada Department of Computer Science University of Manchester

BIOINFORMATICS Ency Lee.

SOFTWARE ENGINEERING ONTOLOGY A DEVELOPMENT METHODOLOGY Projects: eLSE & SELBO Iveta Georgieva.

Biomarkers in Transplantation. A Genome Canada Initiative for Human Health Biomarkers in Transplantation A Knowledge Base for Allograft Rejection Benjamin.

Bioinformatics Needs for the post-genomic era Dr. Erik Bongcam-Rudloff The Linnaeus Centre for Bioinformatics.

Jianlin Cheng, PhD Informatics Institute, Computer Science Department University of Missouri, Columbia Fall, 2011.

Multiscale Information Modelling for Heart Morphogenesis Tariq Abdulla 13 th IMEKO TC1-TC7 Joint Symposium 02/09/2010.

Jeffery Loo NLM Associate Fellow ’03 – ’05 chemicalinformaticsforlibraries.

Fungal Semantic Web Stephen Scott, Scott Henninger, Leen-Kiat Soh (CSE) Etsuko Moriyama, Ken Nickerson, Audrey Atkin (Biological Sciences) Steve Harris.

Storing and Retrieving Biological Instances with the Instance Store Daniele Turi, Phillip Lord, Michael Bada, Robert Stevens.

© Franz Kurfess Project Topics 1 Topics for Master’s Projects and Theses -- Winter Franz J. Kurfess Computer Science Department Cal Poly.

What is an ontology and Why should you care? Barry Smith with thanks to Jane Lomax, Gene Ontology Consortium 1.

Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.

Lawrence Hunter, Ph.D. Director, Computational Bioscience Program University of Colorado School of Medicine

ONCOMINE: A Bioinformatics Infrastructure for Cancer Genomics

Use of Ontologies in the Life Sciences: BioPax Graciela Gonzalez, PhD (some slides adapted from presentations available at

27803::Systems Biology1CBS, Department of Systems Biology Schedule for the Afternoon 13:00 – 13:30ChIP-chip lecture 13:30 – 14:30Exercise 14:30 – 14:45Break.

The bioinformatics of biological processes The challenge of temporal data Per J. Kraulis CMCM, Tartu University.

Triangulation of network metaphors The Royal Netherlands Academy of Arts and Sciences Iina Hellsten & Andrea Scharnhorst Networked Research and Digital.

Systematic Analysis of Interactome: A New Trend in Bioinformatics KOCSEA Technical Symposium 2010 Young-Rae Cho, Ph.D. Assistant Professor Department of.

Bayesian integration of biological prior knowledge into the reconstruction of gene regulatory networks Dirk Husmeier Adriano V. Werhli.

Ontologies: Making Computers Smarter to Deal with Data Kei Cheung, PhD Yale Center for Medical Informatics CBB752, February 9, 2015, Yale University.

Srihari-CSE730-Spring 2003 CSE 730 Information Retrieval of Biomedical Text and Data Inroduction.

Integrating bio-ontologies with a workflow/Petri Net model to qualitatively represent and simulate biological systems Mor Peleg, Irene Gbashvili, and Russ.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Automated Explanation of Gene-Gene Relationships Wacek Kuśnierczyk.

CC 2007, 2011 atribution - R.B. Allen Scholarship, Science, Data, and Domain Informatics.

Graph and Topological Structure Mining on Scientific Articles Fan Wang, Ruoming Jin, Gagan Agrawal and Helen Piontkivska The Ohio State University The.

A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.

Introduction to Bioinformatics Prologue. Bioinformatics Living things have the ability to store, utilize, and pass on information Bioinformatics strives.

Data Analysis Summary. Elephant in the room General Comments General understanding that informatics is integral in medical sequencing and other –omics.

Integrated Biomedical Information for Better Health Workprogramme Call 4 IST Conference- Networking Session.

PattArAn – From Annotation Triplets to Sentence Fingerprints Motivation Motivation  Scientific concepts are annotated with controlled vocabulary (CV)

Semantic Web for Life Sciences Workshop Session VII: Semantic Aggregation, Integration, and Inference Moderator: Joanne Luciano October, Cambridge,

CZ5225 Methods in Computational Biology Lecture 9: Biological pathways and pathway simulation Prof. Chen Yu Zong Tel:

What is an Ontology? An ontology is a specification of a conceptualization that is designed for reuse across multiple applications and implementations.

Gene Ontology TM (GO) Consortium Jennifer I Clark EMBL Outstation - European Bioinformatics Institute (EBI), Hinxton, Cambridge CB10 1SD, UK Objectives:

Cell Signaling Ontology Takako Takai-Igarashi and Toshihisa Takagi Human Genome Center, Institute of Medical Science, University of Tokyo.

Ontologies GO Workshop 3-6 August Ontologies  What are ontologies?  Why use ontologies?  Open Biological Ontologies (OBO), National Center for.

DAVID R. SMITH DR. MARY DOLAN DR. JUDITH BLAKE Integrating the Cell Cycle Ontology with the Mouse Genome Database.

A Biology Primer Part IV: Gene networks and systems biology Vasileios Hatzivassiloglou University of Texas at Dallas.

Workshop Aims NMSU GO Workshop 20 May Aims of this Workshop  WIIFM? modeling examples background information about GO modeling  Strategies for.

DAVID R. SMITH DR. MARY DOLAN DR. JUDITH BLAKE Integrating the Cell Cycle Ontology with the Mouse Genome Database.

Sergey Gromov Yulia Krasilnikova Vladimir Polyakov (NRTU MISIS, Moscow) KNOWLEDGE BASE CREATION FOR NATIONAL NANOTECHNOLOGY NETWORKS «CONSTRUCTIONAL NANOMATERIALS»

1 Gene function annotation. 2 Outline  Functional annotation  Controlled vocabularies  Functional annotation at TAIR  Resources and tools at TAIR.

Ontologies Working Group Agenda MGED3 1.Goals for working group. 2.Primer on ontologies 3.Working group progress 4.Example sample descriptions from different.

Genome Biology and Biotechnology The next frontier: Systems biology Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute.

1 Bioinformatics at Norwegian University of Science and Technology Professor Finn Drabløs Department of Cancer Research and Molecular Medicine Finn Drabløs.

Towards a Top-Domain Ontology for Linking Biomedical Ontologies Holger Stenzhorn a,b Elena Beißwanger c Stefan Schulz a a Department of Medical Informatics,

BioPAX The Birth of A Data Exchange Language for Biological Pathways Joanne Luciano BioPAX Group 7 th International Annual Bio-Ontologies.

EEL 5937 Ontologies EEL 5937 Multi Agent Systems Lotzi Bölöni.

Reverse engineering of regulatory networks Dirk Husmeier & Adriano Werhli.

Discovering functional interaction patterns in Protein-Protein Interactions Networks   Authors: Mehmet E Turnalp Tolga Can Presented By: Sandeep Kumar.

Department of Electrical and Computer Engineering University of Minnesota Presenter: Chi-Yun Cheng Digital Logic with Molecular Reactions.

An Introduction to NCBI & BLAST National Center for Biotechnology Information Richard Johnston Pasadena City College.

Tools in Bioinformatics Ontologies and pathways. Why are ontologies needed? A free text is the best way to describe what a protein does to a human reader.

Effect of Alcohol on Brain Development NormalFetal Alcohol Syndrome.

Knowledge Representation Part I Ontology Jan Pettersen Nytun Knowledge Representation Part I, JPN, UiA1.

Genomics research paper presentation

CCNT Lab of Zhejiang University

A Short Tutorial on Causal Network Modeling and Discovery

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

MAPPFinder and You: An Introductory Presentation

Networked Information Resources

A. P. Shah Institute of Technology

Presentation transcript:

A Knowledge Model for Analysis and Simulation of Signal Transduction Networks

Our project is set up as a collaboration of three departments of Columbia University

Columbia Genome Center Computer Science Department of Medical Informatics

Authors: Tomohiro Koike, Sergey Kalachikov, Shawn M. Gomez, Michael Krauthammer, Sabina H. Kaplan, Pauline Kra, James J. Russo, Carol Friedman, Andrey Rzhetsky

Ontology: collection of concepts concept definitions relationships among concepts properties of each concept [explicit axioms]

Goal – a Particular Application Problem/Motivation: Currently a search through the PubMed system with the keywords “cell cycle” and “apoptosis” produced lists of 169,293 and 29,961 articles, respectively. Clearly it is not feasible to scan all these papers “manually”...

Outline of the system that we are designing

Basic concepts Action, ActionAgent, Process, Publication, Taxon, Disease, Mechanism, Result, Developmental Stage, MicroStructure, State, MacroStructure, Relation, Similarity, RelationType, and ActionTemplate

We represent a pathway a series of overlapping “links” – substance/action/substance triplets Substance A  Substance B  Substance C  Substance D Representation

ActionAgent

Action and Process

Auxiliary Concepts Publication, Taxon, Structure, Developmental Stage, and Disease encapsulate pieces of auxiliary information about ActionAgents, Processes and Actions

Properties of Concepts: ActionAgent

Properties of Concepts: Action

Duality of actions in signal transduction literature

Dualism: in the biochemical representation substance A is not a participant of the action, while it is in the logical representation Logical Biochemical

We realized that the current research literature in molecular biology Describes pathways on two different levels: Logical and Biochemical

A activates B A inactivates B A phoshorylates B A methylates B... logical biochemical

Both logical and biochemical descriptions can be combined in the same sentence: Activated raf-1 phosphorylates and activates mek-1. logical biochemical

Mechanism and Result of an Action

Mechanism and Result Result  LogicalAction Mechanism  BiochemicalAction

Converting LogicalAction into BiochemicalAction and back

The paper descibing this ontology will appear in Bioinformatics A. Rzhetsky, T. Koike, S. Kalachikov, S. M. Gomez, M. Krauthammer, S. H. Kaplan, P. Kra, J. J. Russo and C. Friedman, A knowledge model for analysis and simulation of regulatory networks, Bioinformatics, (accepted) (2000).

Implementation: A Pathway Editor Koike, T., and Rzhetsky, A A graphic editor for analyzing signal transduction pathways. Gene (accepted).

Human cell cycle/apoptosis pathways

Small fragment of the same pathway

O snail, climb Mount Fuji with no hurry Issa

Thank you!