Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Caltech DARPA NSF NASA.

Slides:

Advertisements

Similar presentations

DNA Self-Assembly For Constructing 3D Boxes Ming-Yang KaoVijay Ramachandran Northwestern UniversityYale University Evanston, IL, USANew Haven, CT, USA.

Advertisements

NSF-ITR: EIA : Structural DNA Nanotechnology

Strict Self-Assembly of Discrete Sierpinski Triangles James I. Lathrop, Jack H. Lutz, and Scott M. Summers Iowa State University © James I. Lathrop, Jack.

1Introduction 2Theoretical background Biochemistry/molecular biology 3Theoretical background computer science 4History of the field 5Splicing systems.

Active Tile Self Assembly: Daria Karpenko Department of Mathematics and Statistics, University of South Florida Simulating Cellular Automata at Temperature.

An information-bearing seed for nucleating algorithmic self-assembly Presented by : Venkata Chaitanya Goli Robert D. Barish1, Rebecca Schulman1,

1 SODA January 23, 2011 Temperature 1 Self-Assembly: Deterministic Assembly in 3D and Probabilistic Assembly in 2D Matthew CookUniversity of Zurich and.

Paul Rothemund, Departments of Computer Science and Computation & Neural Systems, California Institute of Technology Jerzy Szablowski : Biological.

The Power of Seeds in Tile Self-Assembly Andrew Winslow Department of Computer Science, Tufts University.

Design of a Minimal System for Self-replication of Rectangular Patterns of DNA Tiles Vinay K Gautam 1, Eugen Czeizler 2, Pauline C Haddow 1 and Martin.

First Blueprint, Now Bricks: DNA is nanoscale construction material. Yamuna Krishnan The Chemical Biology Group National Centre for Biological Sciences,

Mansi Mavani Graduate Student Department of Physics, OSU Stillwater

DNA as a solution of computational problems Radosław Łazarz

Jong-Sun Yi 1. Molecular self-assembly Many top down processes create patterns serially and require extreme conditions. (vacuum, temperature, etc.) Bottom-up,

Self-Assembly Ho-Lin Chen Nov Self-Assembly is the process by which simple objects autonomously assemble into complexes. Geometry, dynamics,

Abstract: Self-assembly is beginning to be seen as a practical vehicle for computation. The assembly of DNA-based tiles into 2D periodic arrays had been.

Topics in Biological Physics Design and self-assembly of two-dimensional DNA crystals Benny Gil 16/12/08 Fig3.a.

DNA Computing by Self Assembly  Erik Winfree, Caltech.

Impact on current processes Acknowledgments Literature Cited Abstract Minimum Pots for the Usual Suspects Recent exciting advances in DNA self-assembly.

What Is the Intellectual Goal of Structural DNA Nanotechnology? Controlling the Structure of Matter in 3D to the Highest Extent (Resolution) Possible,

The Steps in a Walk Sherman, W.B. & Seeman, N.C. (2004), NanoLett. 4,

Ashish Goel Stanford University Joint work with Len Adleman, Holin Chen, Qi Cheng, Ming-Deh Huang, Pablo Moisset, Paul.

Simple Bulged 3-Arm Junction Triangle (1996) J. Qi, X. Li, X. Yang & N.C. Seeman, J. Am. Chem. Soc., 118, (1996).

Origami DNA Edson P. Bellido Sosa.

Can tools & materials of molecular biology be used to make nanoscale objects useful in non-biological applications? Other technologies for making things.

1 Programmable Self-Assembled DNA-Based Autonomous Molecular Devices John Reif Duke University DNA Nanostructure Group John H Reif & Thomas H. LaBean Graduate.

The Tile Complexity of Linear Assemblies Dept of Computer Science, Duke University Harish Chandran, Nikhil Gopalkrishnan, John Reif { harish, nikhil, reif.

Matthew J. Patitz Explorations of Theory and Programming in Self-Assembly Matthew J. Patitz Department of Computer Science University of Texas-Pan American.

DNA Nanostructures and Patterning Taylor Stevenson Nucleic Acid Engineering February 15 th, 2011.

DNA-Scaffolded Self-Assembling Nano-Circuitry An Ongoing Research Project with Dr. Soha Hassoun Presentation by Brandon Lucia and Laura Smith.

DNA Based Self-Assembly and Nano-Device: Theory and Practice Peng Yin Committee Prof. Reif (Advisor), Prof. Agarwal, Prof. Hartemink Prof. LaBean, Prof.

DNA Self-Assembly for Molecular Patterning, Computation and Robotics John H. Reif Computer Science Department Duke University.

Molecular Computations Using Self-Assembled DNA Nanostructures and Autonomous Motors John H. Reif Department of Computer Science, Duke University 1.

Molecular Self-Assembly: Models and Algorithms Ashish Goel Stanford University MS&E 319/CS 369X; Research topics in optimization; Stanford University,

Powering the nanoworld: DNA-based molecular motors Bernard Yurke A. J. Turberfield University of Oxford J. C. Mitchell University of Oxford A. P. Mills.

4/4/20131 EECS 395/495 Algorithmic DNA Self-Assembly General Introduction Thursday, 4/4/2013 Ming-Yang Kao General Introduction.

Algorithmic Self-Assembly of DNA Sierpinski Triangles Ahn, Yong-Yeol Journal Club.

DNA nanotechnology: Geometric sorting boards

DNA Computing and Robotics Based on Deoxyribozymes.

An Introduction to Algorithmic Tile Self-Assembly.

DNA Computing and Assembly

Presented by Pardeep Dhillon and Ehsan Fadaei

TileSoft: Sequence Optimization Software for Designing DNA Secondary Structures P. Yin*, B. Guo*, C. Belmore*, W. Palmeri*, E. Winfree †, T. H. LaBean*

Towards Autonomous Molecular Computers Towards Autonomous Molecular Computers Masami Hagiya, Proceedings of GP, Nakjung Choi

DNA Enzyme reactions Ligation Restriction enzymes Helicase enzymes Polymerization Strand-displacing polymerases.

Complexity of Graph Self-Assembly in Accretive Systems and Self-Destructible Systems Peng Yin Joint with John H. Reif and Sudheer Sahu 1 Department of.

Developing DNA nanotechnology for use in nanoelectronics

Molecular Self-Assembly: Models and Algorithms Ashish Goel Stanford University MS&E 319/CS 369X; Research topics in optimization; Stanford University,

Molecular Algorithms -- Overview

Computational and Experimental Design of DNA Devices

Autonomous DNA Walking Devices

“Molecular Self-Assembly of 3D Nanostructures Using DNA Scaffolding”

Autonomous Programmable Nanorobotic Devices Using DNAzymes

Introduction to Tiling Assembly

Molecular Computation

Programmable DNA Lattices: Design Synthesis & Applications

Paul Rothemund’s Scaffolded DNA Origami Method

Tiing Error Correction & ExperimentsChen

A Sticker-Based Model for DNA Computation

Autonomous Programmable Nanorobotic Devices Using DNAzymes

Strict Self-Assembly of Discrete Sierpinski Triangles

Self-Assembly Ho-Lin Chen Nov

Self-Assembly of Any Shape with

Complexities for the Design of Self-Assembly Systems

Sudheer Sahu John H. Reif Duke University

The Power of Nondeterminism in Self-Assembly

Algorithmic self-assembly with DNA tiles Tutorial

Algorithmic self-assembly with DNA tiles

Algorithms for Robust Self-Assembly

At the Crossroads of Chemistry, Biology, and Materials

Presentation transcript:

Algorithmic self-assembly for nano-scale fabrication Erik Winfree Computer Science Computation & Neural Systems and The DNA Caltech DARPA NSF NASA

Constructing Complex Molecular Objects (Development/Morphogenesis) Information specifies a process that creates organization

Creating Order Blueprints, Template Arbitrary structure. Larger object requires larger template. Periodic crystals Few components, large homogeneous object. Algorithmic growth Few components, large intelligently-organized object.

Nadrian Seeman & DNA nanotechnology

Chemical structure of DNA G A A G T C C T

DNA single-strandeddouble-stranded AGTCTTCGAATGCTAATTGCGCT AGCGCAATTAGCATTCGAAGACT

Designing DNA molecular complexes Nadrian Seeman, 1980’s  GATTACA CTAATGT TAGGCAG ATCCGTC ACTGGTG TGACCAC GATTACA CTAATGT ATCCGTC TGACCACACTGGTG TAGGCAG

Chen and Seeman, Nature 350, 631 (1991).

Periodic 2-tile crystal (DAO-E lattice) TCACT AGTGA CATAC GTATG TCTTG AGAACATCTC TAGAG Winfree, Liu, Wenzler, Seeman, Nature 394: (1998)

Self-Assembly of DNA

High resolution AFM imaging Hole = lattice defect Conformation of helix and sticky ends? Rizal Hariadi, Winfree group crystal growth movie

Some variations Mao, Sun, Seeman, JACS 1999 Winfree, Liu, Wenzler, Seeman, Nature, 1998 LaBean et al, JACS, 2000

More variations 1D ribbons 1D tubes (Schulman, Winfree, 06) Zigzag ribbon 2D periodic lattices Nano-track 3-helix bundle TX-tube 6-helix bundle 4x4 tube DX tube DX lattice TX lattice 4x4 lattices triangle lattice hexagonal lattice 3 point-star lattices symmetry lattice single-strand DX-like tubes … Rhombus ribbon … (Mao, Sun & Seeman, 1999) Rhombus lattice (Mao, Sun & Seeman 99) (Winfree, Liu, Wenzler & Seeman 98) (LaBean, Yan, Kopatsch, Liu, Winfree, Reif, & Seeman 00) (Liu, Park, Reif & LaBean 04) (Liu, Wang, Deng, Walulu & Mao 04) (He, Tian, Chen, Deng, Ribbe & Mao 05) (He, Chen, Liu, Ribbe & Mao 05) (He, Chen, Liu, Ribbe & Mao 05) (Park, Yin, Liu, Reif LaBean & Yan 05) (Park, Barish, Li, Reif, Finkelstein,Yan & LaBean 05) (Rothemund, Ekani-Nkodo, Papadakis, Kumar, Fygenson & Winfree 04) … (Mathieu, Liao, Kopatsch, Wang, Mao & Seeman 05) Chiral DX tube (Mitchell, Harris, Malo, Bath &Turberfield 04) HJ lattice (Malo, Mitchell, Venien- Bryan, Harris,Wille, Sherratt & Turberfield 05) (Reishus, Shaw, Brun, Chelyapov & Adleman 05) DDX lattice (Chelyapov, Brun, Gopalkrishnan, Reishus, Shaw & Adleman 04) (Yan, Park, Finkelstein, Reif & LaBean 03) (Yan, Park, Finkelstein, Reif & LaBean 03) TX ribbon (Li, Park, Reif, LaBean, Yan 03) (Rothemund 05) SAO lattice

DNA computing Adleman, Science (1994) Len Adleman: DNA self-assembly is programmable

The Sierpinski Triangle (aka Pascal’s Triangle mod 2) each new number is the sum of the two below it Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

The Sierpinski Triangle (aka Pascal’s Triangle mod 2) Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

The Sierpinski Triangle (aka Pascal’s Triangle mod 2) Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2:e424, 2004

DAO-E Sierpinski Tile Set decorrelation moviepowers of two movie

Making the boundary (the input string) 750 nm } 25 nm

DAO-E Sierpinski experiments Algorithmic crystals 1.6 um scan decorrelation movie scaffold strand algorithmic growth errors during assembly

DAO-E Sierpinski triangle experiments Paul Rothemund, Nick Papadakis, Erik Winfree, PLoS Biology 2: e424 (2004) 340nm

Scaffolded DNA origami

Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

Folding long single-stranded DNA The sequence of DNA provides unique addresses for each location. “Staple strands” bind locations together according to the design.

Scaffolded DNA origami

Creating Order Blueprints, Template Arbitrary structure. Larger object requires larger template. Periodic crystals Few components, large homogeneous object. Algorithmic growth Few components, large intelligently-organized object.