DNA and Protein Synthesis

Nucleic Acid Review

Name of the molecule identified by the arrow: 1.Phosphate group 2.Nitrogen base 3.Adenine 4.Sugar

Name given to the circled structure: 1.Nucleic acid 2.Amino acid 3.Nucleotide 4.Nucleus

The type of reaction responsible for joining molecules A and B A B 1.Hydrolysis 2.Dehydration

Let’s assume the following strand of DNA contains the information needed to make a protein. This segment of DNA is known as a____: 1.Nucleotide 2.Codon 3.Translation 4.Gene 5.mRNA

Which is single stranded? 1.DNA 2.RNA

Which one can exit the nucleus? 1.DNA 2.RNA

The two strands of DNA are bonded together in the middle by their… 1.Sugars 2.Phosphates 3.Nitrogen bases

Which one contains nitrogenous bases A, T, G and C? 1.DNA 2.RNA

DNA is … 1.Single stranded 2.Double stranded 3.Triple stranded

Every nucleotide is made up of… 1.Sugar 2.Phosphate 3.Nitrogen base 4.All of the above

Nucleic Acids - Function Control the processes of heredity by which cells and organisms reproduce proteins.

Nucleic Acids – Types DNA –Deoxyribonucleic Acid RNA –Ribonucleic Acid

Do you remember DNA structure? SUGAR Phosphate

Let’s build on that knowledge…

Protein Synthesis It’s a process –DNA -> RNA -> Amino Acids (Protein)

RNA Sugar is Ribose NOT what… Has nitrogen base Uracil instead of Thymine –Also contains the other 3 bases…what are they? Only single stranded

RNA

Three processes in this unit… 1. Replication (DNA  DNA) 2. Transcription (DNA  mRNA) 3. Translation (RNA  Protein)

A. DNA Replication 1.Occurs in the nucleus prior to any cell division 2.Enzyme is used to “unzip” or “unwind” the DNA a.Forms a bubble at the origin site

DNA Replication (cont.) 3.Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA a.Nitrogenous bases pair up 1.A – T 2.C - G 4.As a result, you create two identical strands of DNA

Let’s Practice Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

Let’s Build A Protein

Transcription 1.) DNA strand unzips –The bonds between the nitrogen bases are broken –Initiated by RNA polymerase (enzyme) binding to promoter site on DNA 2.) A single strand of mRNA (messenger RNA) is made –Pair up the bases A  T  C  G  The mRNA then travels from nucleus to cytoplasm

Transcription

Where in the cell does transcription take place? 1.Cytoplasm 2.Mitochondria 3.Nucleus 4.Golgi Body 5.Vacuole

Any given segment of DNA has directions that make unique what? 1.Glucose 2.Proteins 3.Lipids 4.Blood cells

If a DNA strand has the following sequence of base pairs – A C T G G T C C A A, then the mRNA strand would have what sequence? 1.T G A C C A G G T T 2.A C T G G T C C A A 3.T G U C C U G G T T 4.U G A C C A G G U U

Why is mRNA called messenger RNA? Because it carries the directions to make a protein to the ribosome like a message

Actually 3 types of RNA mRNA- messenger –Brings message from nucleus to ribosomes in cytoplasm rRNA- ribosomal –Make up a ribosome tRNA- transfer –“transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

The difference between RNA and DNA is what? 1.The phosphates 2.The sugars 3.The nitrogen bases 4.The way the monomer units bond

mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? 1.Mitochondria 2.Ribosome 3.Golgi Body 4.Lysosome 5.Nucleus

Translation 1. mRNA meets up with a ribosome…why?? –Ribosomes are the site for protein production 2. tRNA molecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNA anticodon –Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid –Anticodon: 3 Nitrogen base sequence in tRNA

Translation (cont.) 4.As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

That’s the process, Now how do you know what amino acids make up a particular protein We use an mRNA codon chart

Where in the cell does transcription, the first part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Ribosomes 4.Cytoplasm

DNA has the directions to make what? 1.Glucose 2.Nucleotides 3.Proteins 4.Monosaccharides

After a strand of mRNA is made where does it go? 1.Ribosome 2.Mitochondria 3.Lysosome 4.Vacuole

Where in the cell does translation, the second part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Golgi body 4.Cytoplasm

Molecules called tRNA’s are floating around the cytoplasm carrying what? 1.mRNA’s 2.Glucose 3.DNA 4.Nucleotides 5.Amino Acids

An mRNA codon is made up of how many nitrogen bases?

Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? 1.Phenylalanine 2.Glutamine 3.Asparagine 4.Lysine 5.Tyrosine

What protein would be synthesized from the following mRNA strand? A C U U U C G A A U A C 1.Threonine – phenylalanine – glutamate – tyrosine 2.Phenylalanine – leucine – methionine – valine 3.Tyrosine – glutamate – phenylalanine – threonine 4.Lysine – cysteine – arginine – histidine

What protein would be synthesized from the following DNA segment? T A A G T A C G C T A G 1.Isoleucine – alanine – histidine – alanine 2.Isoleucine – histidine – alanine – isoleucine 3.Phenylalanine – leucine – valine – arginine 4.Isoleucine – leucine – threonine – lysine

How would you assess your comprehension of DNA and Protein Synthesis? 1.A 2.B 3.C 4.D