Chapter 13

The Central Dogma of Biology:

RNA Structure: 1. It is a nucleic acid. 2. It is made of monomers called nucleotides 3. There are two differences between a DNA & an RNA nucleotide: RNAribose - RNA has ribose instead of deoxyribose RNAUracil - RNA has the base Uracil instead of Thymine AdenineUracil - Adenine will pair with Uracil (Uracil is a pyrimidine)

What is transcription? It is the process of making an RNA copy from a DNA template. - All forms of RNA are made using this process. - The process is similar to replication.

The Steps of Transcription: 1. Initiation: promoter RNA polymerase binds to a location on the DNA called a promoter. - Promoters signal the beginning of a gene. - RNA polymerase has the ability to unzip the DNA.

The Steps of Transcription: 2. Elongation: RNA polymerase makes a complementary RNA strand from one of the exposed DNA strands. - This DNA strand is called the “template strand.” (sense strand)

The Steps of Replication: 3. Termination: terminator RNA polymerase comes across a DNA sequence called a “terminator” and stops the transcription process.

Eukaryotic mRNA Transcripts must be edited. introns exons 1. The original mRNA contains sequences known as introns & exons. Introns Introns = sequences that do not code for anything. Exons Exons = sequences that actually code for a protein. 2. The introns are cut out and the exons are spliced together. captail 3. A cap sequence & a tail sequence are added and the mRNA is ready to go.

The Genetic Code: 1. The sequence of the DNA bases “codes” for the individual amino acids in a protein. 2. This code is copied on to an mRNA strand. 3. The mRNA code: codon - 3 mRNA bases in a row are called a codon & each codes for a particular amino acid. 4. Because there are 4 RNA bases, there are 64 different 3-base combinations (10 4 = 64). start codon - One combination is known as the “start codon” (AUG). This marks the beginning of the protein. stop codons - Three of them are “stop codons” (UAA, UAG, UGA). These codons do not code for any amino acids, thus signaling the end of the protein.

What is the amino acid sequence from the following mRNA sequence? AUGGUCGAUAAACCACGCCUGUGA Met-Val-Asp-Lys-Pro-Arg-Leu

What is Translation? Process in which a ribosome reads the mRNA & makes a protein (polypeptide). Ribosome Structure: 1. Has two subunits: small & large 2. Large subunit has two sites: p site p site (polypeptide site) a site a site (amino acid site)

Translation Animation

What is a mutation? Any kind of change to the base sequence of either DNA or RNA. - Mutations cause the amino acid sequence to be incorrect. - An incorrect amino acid sequence usually causes the protein to be nonfunctional or it gives the protein new functions.

1. Gene Mutations (a.k.a. point mutations) These affect a particular gene only. Substitution A. Substitution – replace one base with another. - affects only one amino acid in the protein. - May not even cause a problem (silent mutation). Insertion B. Insertion – a new base is placed in the sequence; this alters the reading frame & every amino acid after the mutation is altered. Deletion C. Deletion – a base is removed & every amino acid after this mutation is altered. Insertionsdeletionsframeshift Insertions & deletions are called frameshift mutations.

2. Chromosomal Mutations 2. Chromosomal Mutations – affect whole chromosomes Deletion A. Deletion – part of the chromosome disappears Duplication B. Duplication – part of the chromosome is copied. Inversion C. Inversion – the sequence of genes on the chromosome is partially flipped. InsertionD. Insertion – part of one chromosome is removed an placed onto a different chromosome Translocation E. Translocation – parts of two chromosomes are clipped off and they switch places.