Announcements: Proposal resubmission deadline 4/23 (Thursday).

Linkage and Mapping

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic mapping I Based on recombination frequencies –The further away two points are on a chromosome, the more recombination there is between them Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic mapping II Genetic mapping requires that a cross be performed between two related organisms –The organism should have phenotypic differences resulting from allele differences at two or more loci The frequency of recombination is determined by counting the F 2 progeny with each phenotype

Linked alleles tend to be inherited together

Crossing over produces new allelic combinations

Map distances are generally additive

A map of the 12 tomato chromosomes Genetic distance is measured by recombination frequency A relative map can be constructed based on genetic distances

Genetic vs. Molecular Maps What is the relationship of genetic distance to molecular distance? How can genetic and molecular relationships be reconciled? How can one be used to locate the other?

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey Genetic markers Genetic mapping between positions on chromosomes –Positions can be genes Responsible for phenotype –Examples: eye color or disease trait –Positions can be physical markers DNA sequence variation

Physical markers Physical markers are DNA sequences that vary between two related genomes Referred to as a DNA polymorphism Usually not in a gene –Examples SSLP (microsatellite) SNP –RFLP –Intergenic SNP –Silent intragenic SNP –Causative point mutation

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey SSLP Simple-sequence length polymorphism Most genomes contain repeats of three or four nucleotides Length of repeat varies Use PCR with primers external to the repeat region On gel, see difference in length of amplified fragment ATCCTACGACGACGACGATTGATGCT ATCCTACGACGACGACGACGACGATTGATGCT

A microsatellite locus can show linkage to a disease gene