B IOLOGY : T HURSDAY, J ANUARY 10 TH Today’s Tasks: DNA Replication Review Transcription Notes Round Robin Practice Remember to turn in you nucleic acids packet!!

D O YOU REMEMBER WHAT PROTEINS ARE MADE OF ? Hundreds of Amino Acids link together to make one Protein. There are 20 types of amino acids, some we can make, and some we can’t. There are infinite combinations of amino acids. These long chains are called polypeptide chains.

P ROTEIN S YNTHESIS Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: DNA is only found in the nucleus Proteins are only made outside the nucleus – in the cytoplasm. Houston, we have a problem.

P ROTEIN S YNTHESIS How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages.

R IBONUCLEIC A CIDS (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mRNA – carries a message from the DNA to the cytoplasm 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein.

R IBONUCLEIC A CIDS (RNA) RNA is almost exactly like DNA, except: Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) Contains uracil instead of thymine. RNA is single-stranded, not double-stranded

RNA VS. DNA

P ROTEIN S YNTHESIS Occurs in TWO steps: 1. Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

T HE C ENTRAL D OGMA This order of events is called the central dogma of molecular biology: DN A RN A P R O T E I N

S TEP O NE : T RANSCRIPTION 1. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. 2. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? 3. New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

S TEP O NE : T RANSCRIPTION Watch this simplified animation: netics/transcription.swf Watch the more complex animation! class.unl.edu/biochem/gp2/m_biology/animation/gene/ gene_a2.html

S TEP O NE : T RANSCRIPTION Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT