Mutations Natural and Artificial Mutations. Mutations There are 2 classes of mutations Nucleotide mutations occur when 1-4 nucleotides are altered, added.

Slides:



Advertisements
Similar presentations
Mutations.
Advertisements

Bacterial Genetics Chapter 8.
Bacterial Genetics. Review Genome: genetic blueprint Gene: Most organisms-DNA Viruses –DNA or RNA.
DNA – Deoxyribose Nucleic Acid 1. DNA is composed of a chain of nucleotides, each made up of a sugar group, a phosphate group, and a nitrogenous base.
DNA damage, repair and recombination
Microbial Genetics. Terminology Genetics Genetics Study of what genes are Study of what genes are how they carry information how they carry information.
Chapter 17.5 Gene expression and Mutations
7 Mechanisms of Mutation and DNA Repair. Mutations Spontaneous mutation : occurs in absence of mutagenic agent Rate of mutation: probability of change.
1 Mutations Mutations are inheritable changes in the DNA –“Failure to faithfully store genetic information” Changes can be to chromosomes or genes –Current.
Transcription, Translation Review. Mutations and Genetic Modifications.
DNA and Genes Unit 4 Chapter 11.
RNA Ribonucleic Acid.
Mutation and Miscellany
Mutations, Mutagenesis, and Repair Chapter 10. The Problem DNA extremely long, fragile DNA extremely long, fragile Subject to both physical and chemical.
Lecture 7 Microbial Genetics: Genetic Mutations Gene Transfer.
Mutations. Learning Objectives By the end of this class you should understand: The pedigree of a spontaneous mutation The concept of mutation rates and.
Mutations. Sickle Cell Anemia Mutations Can be a change in the DNA base sequence or a change in a chromosome Can be a change in the DNA base sequence.
MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.
1 MUTATIONS What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
CHAPTER 7 Gene Experssion and Control Part 3. MUTATED GENES AND THEIR PRODUCTS  Mutations are changes in the sequence of a cell’s DNA.  If a mutation.
Chapter 18 – Gene Mutations and DNA Repair
Gene and Chromosomal Mutations. What is a mutation? Mutations are changes made to an organism’s genetic material. These changes may be due to errors in.
Definition : Any change in the nucleotide sequence of DNA.
Ch Mutations Section Objectives:
Chapter 12 DNA, RNA, Gene function, Gene regulation, and Biotechnology.
13-3 Mutations Can be good, bad or nothing!!. What is a mutation? The word is Latin for “to change”. There are 2 types: – 1) Single gene changes – 2)
Microbial Genetics - Mutation l Mutation - Introduction –A mutation is a change in the DNA sequence that results in a change in the product protein –Mutations.
Chapter 8: Bacterial Genetics. Genetic changes in bacteria occur via: -mutations -gene transfer.
DNA Repair DNA repair is a system used to correct DNA damage caused by either: A- Errors during DNA replication including incorrect base-pairing (mismatching.
Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,
NOTES – CH 17, part 2 DNA & MUTATIONS
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
CH Mutations in Genes Objectives: 1.Describe the following types of mutations: a.Base substitution b.Base insertion or deletion 2. Explain what can.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
DNA: the Molecule of Heredity. DNA DNA is a long molecule made of repeating subunits called nucleotides Nucleotides have three parts sugar phosphate and.
Genetics. Mutations of Genes Mutation – change in the nucleotide base sequence of a genome; rare Not all mutations change the phenotype Two classes of.
Copyright © 2011 Pearson Education Inc. Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville M I C R O B I O L O G Y WITH DISEASES.
Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.
MUTATIONS Chapter 17. Mutation: Effects of changes to the genetic information of a cell or virus. Responsible for huge diversity of genes Source of new.
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
MOLECULAR GENETICS Mutations Definition
Gene Mutations.
Lecture 55 Mutations Ozgur Unal
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
Mutations.
Gene Mutations.
Mutations.
Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.
DNA Mutations Biology 6(E).
Types of Mutations.
MUTATIONS And their effect.
Mutations.
Types of point mutations
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations changes in the DNA sequence that can be inherited
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Mutations.
DNA,RNA,protein synthesis
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Unit 6 Notes: PROTEIN SYNTHESIS & MUTATIONS
Mutations.
STAAR Notebook 2.
Mutations.
Section 20.4 Mutations and Genetic Variation
Mutations: Changes in Genes
DNA Deoxyribonucleic Acid.
Gene Mutations.
Presentation transcript:

Mutations Natural and Artificial Mutations

Mutations There are 2 classes of mutations Nucleotide mutations occur when 1-4 nucleotides are altered, added or removed as a result of damage or errors in replication Transpositions occur when entire sections of DNA “jump” to a different location in the DNA, disrupting genes

Examples of nucleotide mutations Point Mutations – one nucleotide is altered Silent Mutation: CTC to CTT – no change since both codons code for glutamic acid Missense Mutation: CTC to CTA replaces glutamic acid with aspartic acid in hemoglobin since they are functionally similar amino acids, the protein is not greatly affected and the mutation introduces a variation in the species CTC to CAC replaces glutamic acid with valine Valine is hydrophobic and results in clumping of hemoglobin, resulting in sickle cell anemia

Sickle Cell Anemia

Nucleotide Mutations A point mutation could also result in the production of a stop codon in the middle of a gene If this occurs in an essential protein, such as hemoglobin, the mutation is lethal and is called a nonsense mutation Frameshift mutations are also normally lethal – the insertion or deletion of a nucleotide shifts the entire reading frame and every codon is altered

Transposons

Approximately 50 % of the human genome is made up of transposons They can “jump” from one location to another, or they can copy themselves first, and the copy jumps Transposons can cause mutations by inserting themselves into exons, or by taking exons with them; “shuffling” the genetic deck Transposons can jump to a promoter region and either turn off or turn up transcription

Transposons

Artificial Mutation

UV Radiation UV radiation produces covalent bonds between adjacent thymine base pairs These dimers block replication by DNA polymerase Cells can repair the damage by removing the damaged section on one side of the helix DNA polymerase and DNA ligase complete the repair If the repair is done incorrectly, a mutation results

Chemical Mutagens Base analogs Chemicals that have a very similar structure to thymine, uracil, adenine, cytosine or guanine Example: 5’bromouracil Base analogs generally result in point mutations

Chemical Mutagens Acridine dyes These chemicals have a positive charge so they bind to the negatively charged DNA They insert between base pairs and cause frameshift mutations Examples; nitrous acid and hydrazine

Chemical Mutagens Alkylating agents Can transfer methyl groups, ethyl groups, bond with phosphate groups This can result in any type of mutation, including the lethal breakage of the DNA sugar-phosphate backbone They are actually used as chemotherapy in the treatment of cancer, destroying the cancerous cells’ DNA Image from Science Daily