SCIENCE VOL 331 11 FEBRUARY 2011 R01945014 黃博強 R01945037 林彥伯 R01945039 蘇醒宇 R01945043 吳卓翰 R01945046 蘇煒迪 R01945017 陳維.

Slides:



Advertisements
Similar presentations
Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
Advertisements

TIMETABLE 1 BIOINFORMATICS_14 (Advanced Biological Chemistry) 1. Introductory remarks on biochemical information resources.
Next-generation sequencing
The Imperial College Tissue Bank A searchable catalogue for tissues, research projects and data outcomes Prof Gerry Thomas - Dept. Surgery & Cancer The.
Bioinformatics at WSU Matt Settles Bioinformatics Core Washington State University Wednesday, April 23, 2008 WSU Linux User Group (LUG)‏
GENBANK, SWISSPROT AND OTHERS As Problem Sources for CSE 549 Andriy Tovkach Genetics.
Bioinformatics Needs for the post-genomic era Dr. Erik Bongcam-Rudloff The Linnaeus Centre for Bioinformatics.
9 Genomics and Beyond Brief Chapter Outline
Computational Molecular Biology (Spring’03) Chitta Baral Professor of Computer Science & Engg.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.
Welcome to Chem 434 Bioinformatics March 25, 2008 Review of course prerequisites Review of syllabus Review of Bioinformatics Course website Course objectives.
Workshop in Bioinformatics 2010 Class # Class 8 March 2010.
Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.
Many genes have unknown function 30% have unknown function only 9% are experimentally verified The Arabidopsis Genome Initiative, Nature 2000 of the 25,498.
STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2015 Xiaole Shirley Liu Please Fill Out Student Sign In.
Michael Cummings David Reisman University of South Carolina Genomes and Genomics Chapter 15.
From T. MADHAVAN, & K.Chandrasekaran Lecturers in Zoology.. EXIT.
Login: BITseminar Pass: BITseminar2011 Login: BITseminar Pass: BITseminar2011.
Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.
9/30/2004TCSS588A Isabelle Bichindaritz1 Introduction to Bioinformatics.
Bioinformatics.
FLEXGene Consortium Tools for Manipulating the Proteome.
Copyright © 2011, Oracle and/or its affiliates. All rights reserved.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
組員:吳宜瑾 何宜靜 林芳伃 魏裕明 范剛瑋 陳柏融 2012/06/04
Beyond the Human Genome Project Future goals and projects based on findings from the HGP.
Lesson Overview Lesson Overview Studying the Human Genome Lesson Overview 14.3 Studying the Human Genome.
A brief Introduction to Bioinformatics Y. SINGH NELSON R. MANDELA SCHOOL OF MEDICINE DEPARTMENT OF TELEHEALTH Content licensed under.
Finish up array applications Move on to proteomics Protein microarrays.
IPlant cyberifrastructure to support ecological modeling Presented at the Species Distribution Modeling Group at the American Museum of Natural History.
What is Genetic Research?. Genetic Research Deals with Inherited Traits DNA Isolation Use bioinformatics to Research differences in DNA Genetic researchers.
Function first: a powerful approach to post-genomic drug discovery Stephen F. Betz, Susan M. Baxter and Jacquelyn S. Fetrow GeneFormatics Presented by.
Genetics Presentation: Sea Squirts Catherine Dong 9/6/12 Bio303 H Dr. Ely.
Organizing information in the post-genomic era The rise of bioinformatics.
Copyright © 2009 Pearson Education, Inc. Genomics, Bioinformatics, and Proteomics Chapter 21 Lecture Concepts of Genetics Tenth Edition.
Web Databases for Drosophila Introduction to FlyBase and Ensembl Database Wilson Leung6/06.
Harbin Institute of Technology Computer Science and Bioinformatics Wang Yadong Second US-China Computer Science Leadership Summit.
UC Berkeley Clouds Above the clouds : A Berkeley View of Cloud Computing Electrical Engineering and Computer Sciences University of California at Berkeley.
Initial sequencing and analysis of the human genome Averya Johnson Nick Patrick Aaron Lerner Joel Burrill Computer Science 4G October 18, 2005.
Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.
Bioinformatics The application of computer technology to the management of biological information
Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill
Going Against Goliath 23 rd May 2010 Katrina Kurtz, MLIS Carrie Iwema, PhD, MLS Ansuman Chattopadhyay, PhD Health Sciences Library System University of.
Central dogma: the story of life RNA DNA Protein.
EB3233 Bioinformatics Introduction to Bioinformatics.
Bioinformatics and Computational Biology
An approach to carry out research and teaching in Bioinformatics in remote areas Alok Bhattacharya Centre for Computational Biology & Bioinformatics JAWAHARLAL.
Bioinformatics Workshops 1 & 2 1. use of public database/search sites - range of data and access methods - interpretation of search results - understanding.
Johnson - The Living World: 3rd Ed. - All Rights Reserved - McGraw Hill Companies Genomics Chapter 10 Copyright © McGraw-Hill Companies Permission required.
__________________________________________________________________________________________________ Fall 2015GCBA 815 __________________________________________________________________________________________________.
Bioinformatics Dipl. Ing. (FH) Patrick Grossmann
Tools in Bioinformatics Genome Browsers. Retrieving genomic information Previous lesson(s): annotation-based perspective of search/data Today: genomic-based.
Detecting Protein Function and Protein-Protein Interactions from Genome Sequences TuyetLinh Nguyen.
High throughput biology data management and data intensive computing drivers George Michaels.
1 Finding disease genes: A challenge for Medicine, Mathematics and Computer Science Andrew Collins, Professor of Genetic Epidemiology and Bioinformatics.
STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2016 Xiaole Shirley Liu.
Biological Databases By: Komal Arora.
Genomics A Systematic Study of the Locations, Functions and Interactions of Many Genes at Once.
생물정보학 Bioinformatics.
Genomes and Their Evolution
Functional Annotation of the Horse Genome
Access to Sequence Data and Related Information
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
LESSON 1 INTNRODUCTION HYE-JOO KWON, Ph.D /
Introduction to Bioinformatic
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Presentation transcript:

SCIENCE VOL FEBRUARY 2011 R 黃博強 R 林彥伯 R 蘇醒宇 R 吳卓翰 R 蘇煒迪 R 陳維

Introduction

Old Genome Informatics

The Evolution of DNA Sequencing

New Genome Informatics

Dizzy with data

Human Genome Project – Planned for 15 years Celera Genomics – Shotgun Sequencing Method

Shotgun Sequencing Method

Assemble fragments

Dizzy with data After 2005 – Sequence generation – Ability to handle the data “Next-generation” machines – Cheaply – Faster Computer – Memory – Processing

Dizzy with data Genome Project – More Third generation machines – Smaller

3.2 billion base pairs X 1,000 X 10,000 = USD $ 32,000,000 USD$ 3,200

Data storageData transfer

Bioinformatics field tend to archive all raw sequence data. More than 90 GB

Want to analyze a genome? More than 594 GB

Discard the original image files, and only keep the sequence data. If necessary, just re-sequence the sample.

Putting the data in an off-site facility. $0.095 per GB-month of data stored (Singapore) $0.100 per GB-month of data stored (Tokyo) $ $1.000 per GB of data stored

Put one copy of the data in the common cloud which everyone uses. Encouraged by the genomics community – NCBI has put a copy of the data from the pilot project of the 1000 Genomes effort into off-site storage. – Ensemble, the EBI sequence database are automatically funneled into a cloud environment as part of a test of the strategy.

Data involving the health of human subjects, which is being linked more and more to genome information The Health Information Protection Regulations came into force on July 22, – The Health Information Protection Act is designed to improve the privacy of people’s health information while ensuring adequate sharing of information is possible to provide health services.

National Human Genome Research Institute(NHGRI) hosted several meetings on cloud computing and on informatics and analysis in “One thing that is clear is that as computation becomes more and more necessary through- out biomedical research, the way these [infrastructure] resources are funded will have to change to be more efficient,” says James Taylor, a bioinformaticist at Emory University

Growing Exponentially of Data

The primary goal of bioinformatics is to increase the understanding of biological processes But “We live in the post-genomic era, when DNA sequence data is growing exponentially“ Miami University (Ohio) computational biologaist Iddo Friedberg

NCBI Data Growth

EMBL Data Growth

grand area of research Sequence analysis Genome annotation Analysis of gene expression Analysis of protein expression Analysis of mutations in cancer Protein structure prediction Comparative genomics Modeling biological systems High-throughput image analysis Protein-protein docking

Sequence analysis – most primitive operation in computational biology Genome annotation – the process of marking the genes and other biological features in a DNA sequence Analysis of gene expression – The expression of many genes can be determined by measuring mRNA levels

Analysis of protein expression – Gene expression is measured in many ways including mRNA and protein expression Analysis of mutations in cancer – to identify previously unknown point mutations in a variety of genes in cancer Protein structure prediction – important for drug design and the design of novel enzymes

Comparative genomics – the study of the relationship of genome structure and function across different biological species Modeling biological systems – a significant task of systems biology and mathematical biology

High-throughput image analysis – Computational technologies are used to accelerate or fully automate the processing, quantification and analysis of large amounts Protein-protein docking – predict possible protein-protein interactions based on 3D shapes

Obstacles in Computing Technology

Two Ways to Approach higher Computing Ability One Computer Computing Ability Cloud Computing

One Computer Computing Ability TSMC 20nm manufacture procedure No direct co-relation of bus observed data with the internal CPU activity Multi-core processor : record and replay (R&R) system Intel Corporation: Virtues and Obstacles of Hardware-assisted Multi-processor Execution Replay (2010)

Cloud Computing Availability of a Service Data Lock-in Data Confidentiality and Auditability Data Transfer Bottlenecks Performance Unpredictability Scaling Quickly “10 Obstacles To Cloud Computing” By UC Berkeley & How GoGrid Hurdles Them

Cloud Computing

Conclusion Development takes time, effort and money. Computer is still developing fast, without comparing to bio-information.

Thanks for your attention !