12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.

Slides:



Advertisements
Similar presentations
Activity Evolution: a change in populations over successive generations. Complete an Evidence Summary Chart as a class. Identify one pro (positive) and.
Advertisements

Mutations.
What is a Mutation?. change in a DNA sequence that affects genetic information. Mutation:
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
The Code of Life: Topic 3 Gene expression (protein synthesis)
12.4 Mutations. Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription.
Mutations in DNA. Mutations A mutation is a change in a DNA sequence. Can happen if – There is a mistake in replication. – Bases change spontaneously.
Perubahan bahan genetik: Mutasi What is a Mutation? A mutation : a permanent change in the DNA sequence of a gene. Mutations in a gene's DNA sequence can.
Evidence for Evolution Area: Embryology Examples: embryo of pig and human Pro: best evidence because it is the most fundamental or basic information Vocabulary:embryo.
HW # 80- Make cookies for the Cookie Mutation Lab Warm up What are the different types of mutations? How are mutations related to evolution? Place your.
1 Unit 4 The Code of Life. 2 Topic 3 Gene Expression.
Mutations -Start a New Page -Add it to your TOC. Thesunwashotbuttheo ldmandidnotgethishat. This is (kind of) like a strand of DNA. Each letter represents.
Don’t let this happen to you!!. MUTATIONS Changes in DNA that affect genetic information.
Mutations. What is a mutation? b Changes in the DNA sequence that affect genetic information Normal: Thesunwashotbuttheoldmandidnotgethishat. The sun.
Study the diagram below and be prepared to answer the following questions: What processes are represented by the 1, 2 and 3 in the diagram? What processes.
Journal 5-6: A Closer Look at Protein Synthesis And Review of Journal 5-5.
DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.
Genetic Mutations Good, bad or neutral?.
Mutations in DNA changes in the DNA sequence that can be inherited can have negative effects (a faulty gene for a trans- membrane protein leads to cystic.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
1.Most genetic disorders result from a mutation in one gene. a.Mutation: a change in an organism’s genetic material (DNA) 2.A mutated gene produces a.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
Mutations and Genetic Disorders. Review One Wrong Letter Questions to think about: 1) How is the little boy in the video.
Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.
Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.
Mutations.
Mutations and Nature vs. Nurture.
Mutations.
Mutations.
Gene Mutations.
11/29-Don’t Forget About Snork!!
Mutations.
Mutations.
Mutations.
Copyright Pearson Prentice Hall
Menus Have you ever ordered something from a fast food restaurant and the order turned out to be incorrect? What lead to that error?
Mutations.
Mutations.
Mutations. Mutations Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced.
Mutations.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
Mutations Section 12-4.
Mutations.
Turner College & Career High School  2016
Mutations.
Mutations.
Mutations.
Mutations.
Mutations Ms MacCormack Fall 2018.
Mutations.
Bellwork How do we account for the wide variety of organisms that are on the Earth?
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations.
Mutations.
Mutations Good intro video
Mutation Notes.
Mutations.
Mutations.
Mutations in DNA.
Mutations.
Mutations.
Mutations.
Mutations.
Mutations.
Genetic Mutations.
Presentation transcript:

12.4 Mutations

Complete the 2 tables on the first page of your handout. Try this without using your notes first and only refer to your notes on transcription and translation if you are struggling. From your tables and both translated sequences, what do you think a mutation is? Think About It!

What is a mutation? And what can a mutation do?  A mutation is a permanent change in the DNA sequence of a gene.  Mutations in a gene's DNA sequence can alter the amino acid sequence of the protein encoded by the gene.

May occur in somatic cells (aren’t passed to offspring) Skin cancer and leukemia May occur in gametes (eggs & sperm) and be passed to offspring Certain types of cancer: the eye tumor retinoblastoma and Wilms tumor, a childhood malignancy of the kidney. Mutations happen REGULARLY

Most mutations have no effect on gene expression Many mutations are repaired by enzymes Some mutations may improve an organism’s survival (beneficial) and/or produce genetic variety

Mutations to control genes can transform one body part into another. Scientists have studied flies carrying Hox mutations that sprout legs on their foreheads instead of antennae! Polydactyly – Common disorder with extra fingers and/or toes

How do mutations happen?  The DNA sequence of each gene determines the amino acid sequence for the protein it encodes. We can think about the DNA sequence of a gene as a sentence made up entirely of three- letter words: Thesunwashotbuttheoldmandidnotgethishat.  The DNA sequence is interpreted in groups of three nucleotide bases, called codons. The sun was hot but the old man did not get his hat.  Each codon or 3-letter word in this case, specifies a single amino acid in a protein.

This sentence represents a gene. Each letter corresponds to a and each word represents a. What would happen if you shifted the three-letter "reading frame“? You would end up with: T hes unw ash otb utt heo ldm and idn otg eth ish at. Or Th esu nwa sho tbu tth eol dma ndi dno tge thi sha t.

What other types of mutations can occur in DNA sentences? Point mutations are single nucleotide base changes in a gene's DNA sequence. This type of mutation can change the gene's protein product in the following ways:

3 Types of Point Mutations 1. Missense mutations result in a single amino acid change within the protein. 2. Nonsense mutations create a premature "translation stop signal" (or "stop" codon), causing the protein to be shortened. 3. Silent mutations do not cause amino acid changes within the protein.  Ex’s:  Cystic Fibrosis  Neurofibromatosis  Sickle Cell Anemia  Tay-Sachs  Color Blindness

Missense Mutation

Nonsense Mutation

Insertion mutations & deletion mutations  Add or remove one or more DNA bases.  Insertion and deletion mutations cause frameshift mutations, which change the grouping of nucleotide bases into codons. This results in a shift of "reading frame" during protein translation.

Insertion Mutation

Deletion Mutation

Lactose Tolerance Antibiotic Resistance HIV Immunity Malarial Resistance from Sickle Cell Anemia But… mutations can also be beneficial

Mutagens Carcinogens Radiation UV light Environmental Heavy metals Chemical exposure (VOC’s) Bacteria and Viruses Or they could be induced

The World Health Organization’s International Agency for Research on Cancer (IARC) announced that it has moved UV tanning beds to its highest cancer risk category -- "carcinogenic to humans." The use of tanning beds before age 30 is associated with a 75% increase in melanoma risk. Skin cancer occurs when errors (mutations) form the in the DNA of healthy skin cells. The mutations cause the cells to grow out of control and form a mass of cancer cells Skin Cancer

Lung Cancer Smoking causes 87% of all lung cancer cases. Smokers have approximately one chance in 10 of developing lung cancer over his/her lifetime.

Sickle Cell: Mutating virus: geographic-channel/shows/naked-science/ngc-deadly-mutation/ geographic-channel/shows/naked-science/ngc-deadly-mutation/ Radiation leading to mutations and cancer: Addition and deletion mutations: hill.com/sites/ /student_view0/chapter11/animation_quiz_4.htmlhttp://highered.mcgraw- hill.com/sites/ /student_view0/chapter11/animation_quiz_4.html Videos