From Gene to Protein How Genes Work 2007-2008

What do genes code for? How does DNA code for cells & bodies? DNA how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

DNA gets all the glory, but proteins do all the work! The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? transcription translation DNA RNA protein trait To get from the chemical language of DNA to the chemical language of proteins requires 2 major stages: transcription and translation DNA gets all the glory, but proteins do all the work! replication

Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism Am I just the sum of my proteins? metabolic pathway disease disease disease disease A B C D E     enzyme 1 enzyme 2 enzyme 3 enzyme 4

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

from DNA nucleic acid language to RNA nucleic acid language Transcription from DNA nucleic acid language to RNA nucleic acid language 2007-2008

DNA RNA RNA ribose sugar N-bases single stranded lots of RNAs uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble enzyme RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A G T C T T C T C A T A C G DNA T 3 C G T A A T 5 G G C A U C G U T 3 C unwinding G T A G C A rewinding mRNA RNA polymerase template strand build RNA 53 5

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U 5' A 3' G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence

we just broke a biological “rule”! Whoa! I think we just broke a biological “rule”! RNA splicing enzymes snRNPs small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene snRNPs exon intron snRNA 5' 3' spliceosome exon excised intron 5' 3' lariat mature mRNA No, not smurfs! “snurps”

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

from nucleic acid language to amino acid language Translation from nucleic acid language to amino acid language 2007-2008

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA 4 ATCG AUGCGUGUAAAUGCAUGCGCC mRNA 4 AUCG ? Met Arg Val Asn Ala Cys Ala protein 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein

The code Code for ALL life! Code is redundant Start codon Stop codons strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG

How are the codons matched to amino acids? 3 5 DNA TACGCACATTTACGTACGCGG 5 3 mRNA AUGCGUGUAAAUGCAUGCGCC codon 3 5 UAC Met GCA Arg tRNA CAU Val anti-codon amino acid

DNA mRNA protein trait From gene to protein nucleus cytoplasm aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein ribosome trait

Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end

Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small E P A

Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Met U A C 5' U G A 3' E P A

Building a polypeptide 1 2 3 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon Leu Val release factor Ser Met Met Met Met Leu Leu Leu Ala Trp tRNA C A G U A C U A C G A C A C G A C A 5' U 5' U A C G A C 5' A A A U G C U G U A U G C U G A U A U G C U G A A U 5' A A U mRNA A U G C U G 3' 3' 3' 3' A C C U G G U A A E P A 3'

start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… Protein targeting Signal peptide address label start of a secretory pathway

Can you tell the story? RNA polymerase DNA amino acids tRNA pre-mRNA exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNA synthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

Substitute Slides for Student Print version 2007-2008

Can you tell the story?