©C. Allen Black; SunPillar, LLC 2002 Nucline RNA SunPillar, LLC.

Slides:

Advertisements

Similar presentations

How is RNA Transcribed from DNA

Advertisements

DNA Transcription & Protein Translation

Protein Targetting Prokaryotes vs. Eukaryotes Mutations

Cell Division, Genetics, Molecular Biology

JEOPARDY #2 DNA and RNA Chapter 12 S2C06 Jeopardy Review

Gene Expression.

13.3: RNA and Gene Expression

15.2 Regulation of Transcription & Translation

Express yourself That darn ribosome Mighty Mighty Proteins Mutants RNA to the Rescue

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Central Dogma & PCR B Wang Yu-Hsin.

Genes as DNA: How Genes Encode Proteins

Gene Expression Honors Biology.

From Gene to Protein. Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene.

Attenuator Sequence AUG E * AUG D * AUG C * AUG B * AUG A * Trp structural genes P Trp O 1234 AUGUGAUUUUUUUUUUGGUGG The Trp operon is controlled by negative.

Protein Synthesis Also Known As … Decoding the Central Dogma.

How Are Genes Expressed? Chapter11. DNA codes for proteins, many of which are enzymes. Proteins (enzymes) can be used to make all the other molecules.

GENE EXPRESSION AND MUTATION. GENE EXPRESSION IN PROKARYOTES - A gene is being “expressed” or “activated” when a protein is being made -Some are expressed.

SiRNA and Epigenetic Asma Siddique Saloom Aslam Syeda Zainab Ali.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

DNA, RNA, and Proteins Section 3 Section 3: RNA and Gene Expression Preview Bellringer Key Ideas An Overview of Gene Expression RNA: A Major Player Transcription:

Transcription and Translation.  Genes: are segments of DNA that code for proteins  Most nucleotide base sequences in DNA don’t code for anything  ATGCGAATCGTAGCATACGATGCATGCACGTG.

From Gene to Protein Transcription and Translation Mechanisms of Regulation DNA  RNA  Protein Transcription Translation.

Control of Gene Expression Year 13 Biology. Exceptions to the usual Protein Synthesis Some viruses contain RNA and no DNA. RNA is therefore replicated.

The Lac Operon An operon is a length of DNA, made up of structural genes and control sites. The structural genes code for proteins, such as enzymes.

All cells in a person have the same DNA Yet eye cells differ from nose cells Central dogma of biology Genetic engineeri ng Tissue therapy.

Genetic Engineering Application of techniques of molecular cloning and transformation.

Mandal CC et al Supplementary Fig. S1. Increased expression of CSF-1 in human breast cancer cells. (A) The conditioned media from normal human breast epithelial.

Protein Synthesis Transcription and Translation. Protein Synthesis: Transcription Transcription is divided into 3 processes: –Initiation, Elongation and.

Chapter 17 From Gene to Protein. 2 DNA contains the genes that make us who we are. The characteristics we have are the result of the proteins our cells.

Protein Synthesis Translation. Protein Synthesis.

(Foundation Block) Dr. Sumbul Fatma

Some basic molecular biology Summaries of: Replication, Transcription; Translation, Hybridization, PCR Material adapted from Lodish et al, Molecular Cell.

Gene Expression Honors Biology.

Copyright © 2011 Pearson Education Inc. Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville M I C R O B I O L O G Y WITH DISEASES.

Chapter 13: Gene Regulation. The Big Picture… A cell contains more genes than it expresses at any given time – why? Why are cells in multicellular organisms.

Products > PC-3 Transfection Reagent (Prostate Cancer Cells) Altogen Biosystems offers the PC-3 Transfection Reagent among a host of 100+ cell line specific.

Products > MCF-7 Transfection Reagent (Breast Cancer, HTB-22) Altogen Biosystems offers the MCF-7 Transfection Reagent among a host of 100+ cell line specific.

Products > Transfection Reagent for C6 Cells (Glioma Cells, CCL-107) Altogen Biosystems offers the C6 Transfection Reagent among a host of 100+ cell line.

Lipofection (or liposome transfection) is a technique used to inject genetic material into a cell by means of liposomes, which are vesicles that can easily.

Gene Structure and Regulation. Gene Expression The expression of genetic information is one of the fundamental activities of all cells. Instruction stored.

Products > Liver In Vivo Transfection Kit

Transcription, RNA Processing, & Translation

Transcription, RNA Processing, & Translation

Altogen labs Leading Developer and Manufacturer of In Vivo and DNA Transfection Kits, Transfection Reagents and Electroporation Delivery Products Products.

Chapter 21 Nucleic Acids and Protein Synthesis

Products > BT-20 Transfection Reagent (Breast Carcinoma Cells)

Transcription Translation

Context Cell nucleus chromosome gene double helix.

Section 3: RNA and Gene Expression

Technical Aspects of Recombinant DNA and Gene Cloning

Gene Expression 3B – Gene regulation results in differential gene expression, leading to cell specialization.

Genetic Engineering and Gene Expression

Concept 18.5: Cancer results from genetic changes that affect cell cycle control The gene regulation systems that go wrong during cancer are the very same.

RNA (Ribonucleic acid)

Lecture 4 By Ms. Shumaila Azam

PROTEIN SYNTHESIS An individual’s characteristics are determined by their DNA. The DNA code determines which proteins are made. The sequence of bases in.

Eukaryote Regulation and Gene Expression

DEPTOR, an mTOR Inhibitor, Is a Physiological Substrate of SCFβTrCP E3 Ubiquitin Ligase and Regulates Survival and Autophagy Yongchao Zhao, Xiufang Xiong,

DNA Replication How to make a functional protein Transcription

Protein Synthesis: Transcription

Gene Expression Activation of a gene to transcribe DNA into RNA.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

Protein Synthesis The genetic code – the sequence of nucleotides in DNA – is ultimately translated into the sequence of amino acids in proteins – gene.

An Overview of Gene Expression

LAST UNIT! Energetics.

Prokaryotes Eukaryotes

Presentation transcript:

©C. Allen Black; SunPillar, LLC 2002 Nucline RNA SunPillar, LLC

©C. Allen Black; SunPillar, LLC What is Nucline? Nucline is a full length mRNA molecule. It is conditionally translated into a protein. Protein is only expressed when researcher-defined gene profiles are present in the cell. It can be used to modify, tag, and even destroy cells that express the gene profile. It is not siRNA (methylates target DNA) or antisense (blocks mRNA translation.) These only “turn off”/”turn down” protein expression.

©C. Allen Black; SunPillar, LLC mRNA translation 30s ribosome subunit binds the 5’ cap. It scans through the mRNA sequence. It stalls at the AUG start condon, binds the 50s subunit and beings translating the protein. The 5’ Untranslated Region (UTR) upstream of the start codon regulates scanning and initiation.

©C. Allen Black; SunPillar, LLC mRNA can be “blocked” by 5’ UTR secondary structure The ribosome requires energy to scan through the UTR. A mRNA with strong secondary structure prevents the ribosome from ever reaching the AUG codon. The ribosome cannot melt the structure. E.g. Antisense, stem-loops, and hairpins impede the ribosome and prevent translation.

©C. Allen Black; SunPillar, LLC Nucline: designing a “drug” by example Pick a disease: B cell lymphoma Pick what gene you wish the target cell to express: pertussis toxin (suicide gene) Pick sequences (normal or mutant) that are only expressed in B cell lymphoma (mutant c-myc and IgM) Insert construct into an mRNA transcription vector, runoff mRNA, and ligate repressors. Deliver mRNA via liposomes, virosomes, ballistic penetration, electroporation etc.

©C. Allen Black; SunPillar, LLC Step 1: the protein Construct suicide gene. AUG placed upstream of pertussis toxin. All transfected cells will die. mRNA permanently “on.” No secondary structure.

©C. Allen Black; SunPillar, LLC Step 2: the 5’UTR Place sense sequences (100bp) corresponding to c- myc and IgM in the 5’UTR. All transfected cells will die. mRNA permanently “on.” No secondary structure present.

©C. Allen Black; SunPillar, LLC Step 3: Ligate antisense Add antisense sequences (100 bp) complementary to IgM and c-myc in the 5’UTR.

©C. Allen Black; SunPillar, LLC Nucline in normal cells In IgM -, c-myc - cells, antisense stays “stuck” to Nucline. The antisense has only Nucline coded sense sequences to bind. No translation in normal cells.

©C. Allen Black; SunPillar, LLC Nucline in normal B cells. Anti-sense will hybridize to its complements. In normal B cells (non-c-myc cells), IgM wt mRNA competes off the antisense. The antisense “choses” between binding Nucline or wt IgM RNA. Both have sense sequences so competitive hybridization occurs. The c-myc antisense stays “stuck” to Nucline. Still, no translation. Half of secondary structure still present.

©C. Allen Black; SunPillar, LLC Nucline in B cell lymphoma. Anti-sense will hybridize to its complements. IgM wt mRNA competes off the IgM antisense. c-myc wt RNA competes off the c-myc antisense. TRANSLATION. All of secondary structure removed.

©C. Allen Black; SunPillar, LLC But this is biology, will it really work?

Detecting Estrogen Receptor Overexpression Using the plasmid provided the GFP along with the ER regions was amplified using the two primers Nucln FP and Nucln RP. RNA was synthesized using this PCR DNA and Ribomax kit from Promega. MCF-7 cells were purchased from ATCC and were grown in RPMI medium with 10% fetal calf serum. For transfection 1 ug RNA was mixed 1ug of Nucline and boiled for 10 min and allowed to hybridize. To this 2 ul of Tfx-50 reagent (Promega) was added and incubated for 10 min with 300 ul serum free medium. This was added to MCF-7 cells, after washing the monolayer with RPMI without serum. The cell density was about 60 to 70%. Transfection was allowed for 30 min after which the medium was removed and replaced by serum containing medium. The cells were observed under microscope after 24 hrs post-transfection ER Target Sequence: 5’ ggtcacgtggtaactatttggtcacgtggtaactattt Special Thanks to Dr. Augustine Rajakumar (University of Pittsburgh) and Dr. Yunus Luqmani (Kuwait University) for providing these Estrogen Receptor data. ©C. Allen Black; SunPillar, LLC

MCF-7 Cells (Bright Field) ©C. Allen Black; SunPillar, LLC

MCF-7 Positive Control GFP Plasmid ©C. Allen Black; SunPillar, LLC

Nucline Transfection Specific for Estrogen Receptor Overexpression ©C. Allen Black; SunPillar, LLC

Repeated Again ©C. Allen Black; SunPillar, LLC

What about in vivo? Mouse solid tumor model (MM2MT breast carcinoma). DeFatta, RJ, Li, Y., De Bendetti, Cancer Gene Therapy 9:503 (2002). Introduced RNA with impenetrable 5’ UTR (hairpins). RNA coded suicide gene. DNA coding the RNA was lipofected into animals. eIF4E (cap binding protein) over expressed in tumor, not regular cells. It “melts” RNA structure in cancer but not normal cells. 120 day survival: 0/10 control; 7/10 experimental. 70% cure rate.

©C. Allen Black; SunPillar, LLC Curing Cancer (in mice) DeFatta et al. used “protein assisted” melting. Nucline uses “sequence assisted” competitive hybridization to melt secondary structure. Nucline is sequence specific, eIF4E melts any secondary structure. Mode of melting irrelevant for biological effect RNA with de-repressible secondary structure (confering specificity) cures cancer in mice. Nucline design increases the utility and specificity.

©C. Allen Black; SunPillar, LLC Uses FACS (deliver fluorescent protein) (+)/(-) cell selection (suicide/proliferation inducing genes) Disease models (suicide genes, repair genes) Wound repair/gene defects (deliver proliferation inducing genes or new “correct” gene) Detect mRNA/(s)tructural RNA profiles, mRNA/sRNA concentration, mRNA/sRNA sequences.

©C. Allen Black; SunPillar, LLC Nucline Logic It is a logic system where A,B are cellular mRNA sequences and Y is a protein to be expressed in those cells alone. IF A is present, THEN release Y. (One antisense blocking translation) IF A and B are present, THEN release Y. (different antisense targets on same Nucline RNA, e.g. lymphoma Nucline) IF A or B is present, THEN release Y. (Combine two different kinds of Nucline molecules) IF A is present > 100 copies, THEN release Y. (Nucline with 101 redundant antisense stuck to it) IF A but not B present, THEN release Y. (advancing) IF A present < 100 copies, THEN release Y. (advancing)

©C. Allen Black; SunPillar, LLC