A.Gene Mutation 1. Mutations are Classified in Different Ways: 2. The Rates of Spontaneous Mutations: 3. How Spontaneous Mutations Occur: 4. Mutagens and Their Effects: a. Base Analogs: these are other chemicals that mimic one base and are inserted in DNA replication, but have higher rates of tautomerism and change to bind a new base.

Tautomeric shift

A.Gene Mutation 1. Mutations are Classified in Different Ways: 2. The Rates of Spontaneous Mutations: 3. How Spontaneous Mutations Occur: 4. Mutagens and Their Effects: a. Base Analogs: b. Alkylating Agents and Acridine Dyes: Acridine dyes insert themselves in the template and change the distance between bases, typically resulting in a base being missed during replication (nitrous acid (HNO2), hydroxylamine, hydrazine, H2O2).

A.Gene Mutation 1. Mutations are Classified in Different Ways: 2. The Rates of Spontaneous Mutations: 3. How Spontaneous Mutations Occur: 4. Mutagens and Their Effects: a. Base Analogs: b. Alkylating Agents and Acridine Dyes: c. Radiation: - UV Causes neighboring T’s to bind (thymidine dimer), screwing up replication

A.Gene Mutation 1. Mutations are Classified in Different Ways: 2. The Rates of Spontaneous Mutations: 3. How Spontaneous Mutations Occur: 4. Mutagens and Their Effects: a. Base Analogs: b. Alkylating Agents and Acridine Dyes: c. Radiation: - UV - high energy (cosmic, gamma, X)

A.Gene Mutation 1. Mutations are Classified in Different Ways: 2. The Rates of Spontaneous Mutations: 3. How Spontaneous Mutations Occur: 4. Mutagens and Their Effects: 5. Detecting Mutagens: The Ames test:

Use a strain of Salmonella bacteria that cannot synthesize the amino acid histidine.

Plate it on a his- medium and look for colonies that CAN synthesize their own histidine and must have mutated.

Use a strain of Salmonella bacteria that cannot synthesize the amino acid histidine. Plate it on a his- medium and look for colonies that CAN synthesize their own histidine and must have mutated. Add liver enzymes because many compounds are not mutagenic until the are digested or ‘detoxified’ by liver

Use a strain of Salmonella bacteria that cannot synthesize the amino acid histidine. Plate it on a his- medium and look for colonies that CAN synthesize their own histidine and must have mutated. Compare spontaneous rates to rates in presence of compound Add liver enzymes because many compounds are not mutagenic until the are digested or ‘detoxified’ by liver

A.Gene Mutation B. DNA Repair - All organisms have repair mechanisms that can proof-read and correct errors in replication, and can repair damaged DNA in cells.

A.Gene Mutation B. DNA Repair 1.Proofreading: DNA polymerases have exonuclease activity; so when they add an incorrect base, they can cleave it out and replace it with a new one…this reduces error rate 100-fold.

A.Gene Mutation B. DNA Repair 1.Proofreading: 2. Mismatch repair: mismatched can be detected by enzymes; but how do they recognize which base is wrong?

A.Gene Mutation B. DNA Repair 1.Proofreading: 2. Mismatch repair: mismatched can be detected by enzymes; but how do they recognize which base is wrong? - prior to synthesis, a methylase enzyme recognizes the sequence GATC and methylates the adenine on both template strands. CTAG

A.Gene Mutation B. DNA Repair 1.Proofreading: 2. Mismatch repair: mismatched can be detected by enzymes; but how do they recognize which base is wrong? - prior to synthesis, a methylase enzyme recognizes the sequence GATC and methylates the adenine on both template strands. CTAG - after replication, if the mismatch is recognized by the repair enzyme, it cuts the unmethylated strand and cleaves bases through the mismatch site. Polymerase fills the gap and ligase links the last phosphodiester bond. CGCTACGGATCCGTGTACATGGATCCTAG GCGATGCCTAGGCATATGTACCTAGGATC Mismatched pair… which is the correct base, G or T?

A.Gene Mutation B. DNA Repair 1.Proofreading: 2. Mismatch repair: mismatched can be detected by enzymes; but how do they recognize which base is wrong? 3. Recombinational Repair: Sometimes the polymerase will just skip over a thymidine dimer, creating a ‘lesion’ (gap). Recombination enzymes will repair the gap with the AA sequence from the other chromatid, which provides the A’s necessary to bind the thymines correctly. The gap in the chromatid can easily be filled because the template is correct.

A.Gene Mutation B. DNA Repair 1.Proofreading: 2. Mismatch repair: mismatched can be detected by enzymes; but how do they recognize which base is wrong? 3. Recombinational Repair: There is a similar pattern, of using the homolog, in double-break repair

Nucleotide Excision Repair 30 genes regulate the recognition, excision, and repair of thymidine dimers. Xeroderma pigmentosum: Mutations in these genes involved in repair mean that mutations persist.

Cancer

A.What is Cancer? - Cancer is characterized by proliferation (growth and division of cells) and metastasis (infection of new tissues).

Cancer A.What is Cancer? - Cancer is characterized by proliferation (growth and division of cells) and metastasis (infection of new tissues). PROLIFERATION forms a tumor. If this tumor is localized and the cells are immobile, it is benign. If cells in the tumor gain the ability to migrate to other tissues, then the tumor is malignant and can metastasize.

Cancer A.What is Cancer? - Cancer is characterized by proliferation (growth and division of cells) and metastasis (infection of new tissues). - It (they – because they are a body of different diseases) is a GENETIC disease, caused by genetic changes in the cell that leads to the characteristics, above.

Cancer A. What is Cancer? - Cancer is characterized by proliferation (growth and division of cells) and metastasis (infection of new tissues). - It (they – because they are a body of different diseases) is a GENETIC disease, caused by genetic changes in the cell that leads to the characteristics, above. - However, cancer is usually not heritable: it affects somatic tissue. Rather, the genetic susceptibility to mutagens may be heritable.

Cancer A.What is Cancer? - Cancer is characterized by proliferation (growth and division of cells) and metastasis (infection of new tissues). - It (they – because they are a body of different diseases) is a GENETIC disease, caused by genetic changes in the cell that leads to the characteristics, above. - However, cancer is usually not heritable: it affects somatic tissue. Rather, the genetic susceptibility to mutagens may be heritable. - Finally, it is not a single-gene disease; it is usually caused by several mutations that affect cell division and DNA repair. Of course, when these things are affected, mutations accumulate and the problems get worse in the cell…leading to large scale chromosomal aberrations

Cancer A.What is Cancer? - All cells in a tumor are descended from one initial cancer cell that finally accumulated enough mutations in CDC genes to proliferate. Evidence: Within a tumor in a female, all cells have the same X inactivated…suggesting they are descended from a single cell.

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes 1. XP – xerodermal pigmentosum – a rare hereditary cancer People with XP have mutations in one of the seven proteins needed for thymidine dimer repair… so UV light causes accumulated damage that eventually affects CDC genes and causes proliferation and malignancy.

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes 1. Most mature cells enter a quiescent and specialized G0 stage, in which they no longer divide unless stimulated by external growth signals (hormones or growth factors).

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes 1. Most mature cells enter a quiescent and specialized G0 stage, in which they no longer divide unless stimulated by external growth signals (hormones or growth factors). 2. The binding of these signals to the outside of the cell membrane activates “signal transduction” molecules on the inside of the membrane; these set off a cascade of events that ultimately stimulate division and return the cell from the G0 to the G1 and the divisional cell cycle.

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes 1. Most mature cells enter a quiescent and specialized G0 stage, in which they no longer divide unless stimulated by external growth signals (hormones or growth factors). 2. The binding of these signals to the outside of the cell membrane activates “signal transduction” molecules on the inside of the membrane; these set off a cascade of events that ultimately stimulate division and return the cell from the G0 to the G1 and the divisional cell cycle. 3. Signal transduction is also involved in signaling the cell to stop growing and enter G0.

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes 1. Most mature cells enter a quiescent and specialized G0 stage, in which they no longer divide unless stimulated by external growth signals (hormones or growth factors). 2. The binding of these signals to the outside of the cell membrane activates “signal transduction” molecules on the inside of the membrane; these set off a cascade of events that ultimately stimulate division and return the cell from the G0 to the G1 and the divisional cell cycle. One major family of signal transduction genes are ras genes. 3. Sometimes, cancer is caused by: - mutations in signal transduction genes that stay on – even if cue is not present; or stay on, even if inhibitor is present.

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes D. Regulation of the Cell Division Cycle

1. In order for the G1/S transition, about genes must be turned on (to make all the replication enzymes, origin replicating factors, etc.) G1/S checkpoint

1.In order for the G1/S transition, about genes must be turned on (to make all the replication enzymes, origin replicating factors, etc.) 2.These genes are “up-regulated” by the binding of E2F transcription factors to their promoters…. G1/S checkpoint E2F

1.In order for the G1/S transition, about genes must be turned on (to make all the replication enzymes, origin replicating factors, etc.) 2.These genes are “up-regulated” by the binding of E2F transcription factors…. 3.But during G1, E2F’s are bound by the retinoblastoma protein (RB) and CAN’T bind to DNA and activate the replication genes… So the RB protein is a cell-progression inhibitor. G1/S checkpoint E2F RB

3.But during G1, E2F’s are bound by the retinoblastoma protein (RB) and CAN’T bind to DNA and activate the replication genes… So the RB protein is a cell-progression inhibitor. 4.Now, RB can be inactivated by phosphorylation – which is what kinases do. These kinases are present all the time, but they are activated by cyclins whose concentrations vary through the cell cycle… so these are cyclin-dependent kinases or CDK’s. G1/S checkpoint E2F RB

4.Now, RB can be inactivated by phosphorylation – which is what kinases do. These kinases are present all the time, but they are activated by cyclins whose concentrations vary through the cell cycle… so these are cyclin- dependent kinases or CDK’s. 5.SO! [Cyclin D2] increase through G1…. They bind/activate CDK4 and CDK6… G1/S checkpoint E2F RB D2 CDK4 PO4

4.Now, RB can be inactivated by phosphorylation – which is what kinases do. These kinases are present all the time, but they are activated by cyclins whose concentrations vary through the cell cycle… so these are cyclin- dependent kinases or CDK’s. 5.SO! Cyclin D2 increase through G1…. They bind/activate CDK4 and CDK6… which phosphorylate RB, inactivating it such that it releases E2F. … which is now free to stimulate transcription of replication genes needed for the S phase. So cyclin D2 stimulate cell cycle and cell division and proliferation. What influences the concentration of cyclin D? G1/S checkpoint E2F RB D2 CDK4 PO4

Myc is a transcription factor that stimulates cyclinD production and down-regulates p21 activity … so it stimulates cell proliferation. (It binds to enhancer regions and may stimulate up to 15% of all genes. Its binding moves histones off genes, allowing them to be turned on further. It is important in stimulating protein synthesis and cell growth, as well as cell proliferation. First found in Burkitt’s lymphoma, where enhancers are translocated to chromosome 8 and lock it in the ‘on’ position. Sequence similar to an avian virus that causes myelocytomatosis…”myc”)

Myc is a transcription factor that stimulates cyclinD production … so it stimulates cell proliferation. P53 is a transcription factor that increases in concentration when there is DNA damage. It stimulates production of the p21 protein, which blocks CDK4 activity, and the RB protein remains bound to E2F’s and cell progression is stalled. So, p53 is a cell-cycle inhibitor. 50% of all cancers involve mutations in the p53 gene, removing this inhibiting effect!

The other critical checkpoint is the G2/M transition, which is regulated by the binding of cyclin-B to CDK1. It reorganizes the cytoskeleton to form the spindle, and stimulates the formation of Anaphase Promoting Complexes. Eventually, the APC’s are activated, and they digest the protein in the kinetochore holding the sister chromatids together, and they also digest cyclin-B in a negative feedback loop. APC’s Separation of chromatids Degradation of Cyclin B

Cancer A.What is Cancer? B. Cancer can occur because of mutations in DNA Repair Genes C. Ultimately, however, proliferation is caused by mutations in CDC genes D. Regulation of the Cell Division Cycle E. Oncogenes, Tumor Supressors, and Viruses

E. Oncogenes, Tumor Supressors, and Cancer 1. Oncogenes: In a rather backwards way, “oncogenes” are mutated genes that cause cancer by over-stimulating cell division. Their unmutated normal form are called “proto-oncogenes” that stimulate division correctly.

E. Oncogenes, Tumor Supressors, and Cancer 1. Oncogenes: In a rather backwards way, “oncogenes” are mutated genes that cause cancer by over-stimulating cell division. Their unmutated normal form is called a “proto-oncogenes” and they stimulate division correctly. The classic example is the ras oncogene family, that function in signal transduction pathways. (“ras” because it was first isolated in rat sarcoma cancers.)

1. A growth factor binds to a receptor on the membrane, causing its activation (phosphorylation)

2.Through protein intermediates, this causes the ras protein to release GDP and bind GTP, activating it.

1.A growth factor binds to a receptor on the membrane, causing its activation (phosphorylation) 2.Through protein intermediates, this causes the ras protein to release GDP and bind GTP, activating it. 3.Ras initiates a phosphorylation cascade, ultimately stimulating kinases that…

1.A growth factor binds to a receptor on the membrane, causing its activation (phosphorylation) 2.Through protein intermediates, this causes the ras protein to release GDP and bind GTP, activating it. 3.Ras initiates a phosphorylation cascade, ultimately stimulating kinases that… 4.Initiate a signal transduction pathway across the nuclear membrane, stimulating transcription factors that regulate cell proliferation genes.

1.A growth factor binds to a receptor on the membrane, causing its activation (phosphorylation) 2.Through protein intermediates, this causes the ras protein to release GDP and bind GTP, activating it. 3.Ras initiates a phosphorylation cascade, ultimately stimulating kinases that… 4.Initiate a signal transduction pathway across the nuclear membrane, stimulating transcription factors that activate cell proliferation genes. 5.Critically, after initiating the cascade, ras hydrolyzes GTP to GDP and becomes inactive again.

1.A growth factor binds to a receptor on the membrane, causing its activation (phosphorylation) 2.Through protein intermediates, this causes the ras protein to release GDP and bind GTP, activating it. 3.Ras initiates a phosphorylation cascade, ultimately stimulating kinases that… 4.Initiate a signal transduction pathway across the nuclear membrane, stimulating transcription factors that activate cell proliferation genes. 5.Critically, after initiating the cascade, ras hydrolyzes GTP to GDP and becomes inactive again But WHEN mutated to an oncogene, it does NOT hydrolyze GTP – and remains active – continuing to stimulate the cell proliferation cascade. Ras mutations occur in 40% of cancers.

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: These are genes that normally inhibit cell division. When mutated, that inhibition is released and the cell divides. The p53 gene is an example, as is RB and BRCA2 that is associated with breast cancer.

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: These are genes that normally inhibit cell division. When mutated, that inhibition is released and the cell divides. The p53 gene is an example. P53 also can initiate apoptosis – programmed cell death – if there is too much DNA damage.

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: These are genes that normally inhibit cell division. When mutated, that inhibition is released and the cell divides. The p53 gene is an example. P53 also can initiate apoptosis – programmed cell death – if there is too much DNA damage. So, mutations in this gene short-circuit cell regulation and cell suicide; resulting in the survival and replication of cells with very damaged DNA - cancer!!

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: 3. Viruses: Viruses cause 15% of all human cancers. Viruses cause cancer 2 ways: 1) viruses insert their DNA into the hosts genome. The sites of insertion may “up-regulate” proto-oncogenes or destroy tumor suppressor genes.

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: 3. Viruses: Viruses cause 15% of all human cancers. Viruses cause cancer 2 ways: 1) viruses insert their DNA into the hosts genome. The sites of insertion may “up-regulate” proto-oncogenes or destroy tumor supressor genes. 2) Also, when the viral DNA is replicated, it may copy a neighboring proto-oncogene, as well. This now becomes part of the viral genome – a “viral oncogene”.

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: 3. Viruses: Viruses cause 15% of all human cancers. Viruses cause cancer 2 ways: 1) retroviruses insert their DNA into the hosts genome. The sites of insertion may “up-regulate” proto-oncogenes or destroy tumor supressor genes. 2) Also, when the viral DNA is replicated, it may copy a neighboring proto-oncogene, as well. This now becomes part of the viral genome – a “viral oncogene”. - when it’s inserted in a new host, it is overexpressed - or, it gets mutated and is even MORE overexpressed…

E. Oncogenes, Tumor Supressors, and Viruses 1. Oncogenes: 2. Tumor Suppressors: 3. Viruses: 4. Environmental Mutagens: - Anything that damages DNA can cause cancer, if it ends up damaging cdc genes. Tobacco has chemicals that preferentially mutate ras and p53.