BIOINFORMATICS PROGRAM St. Edward’s University Genomics Education Partnership (GEP) Genomics Consortium for Active Teaching (GCAT)

Slides:

Advertisements

Similar presentations

Parallel BioInformatics Sathish Vadhiyar. Parallel Bioinformatics  Many large scale applications in bioinformatics – sequence search, alignment, construction.

Advertisements

Metabarcoding 16S RNA targeted sequencing

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.

Bioinformatics: One Minute and One Hour at a Time Laurie J. Heyer L.R. King Asst. Professor of Mathematics Davidson College

B IOINFORMATICS S UMMER A CADEMY J UNE

MARCUS LYON Bioinformatics Workshop Why I’m Here Gain a better understanding of bioinformatics  Benefit my current/future research  Useful information.

Sequence Similarity Searching Class 4 March 2010.

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

Bioinformatics and Phylogenetic Analysis

Introduction to Computational Biology Topics. Molecular Data Definition of data  DNA/RNA  Protein  Expression Basics of programming in Matlab  Vectors.

Kate Milova MolGen retreat March 24, Microarray experiments. Database and Analysis Tools. Kate Milova cDNA Microarray Facility March 24, 2005.

Scientific Data Mining: Emerging Developments and Challenges F. Seillier-Moiseiwitsch Bioinformatics Research Center Department of Mathematics and Statistics.

Sequence Alignment III CIS 667 February 10, 2004.

Signaling Pathways and Summary June 30, 2005 Signaling lecture Course summary Tomorrow Next Week Friday, 7/8/05 Morning presentation of writing assignments.

CISC667, F05, Lec27, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) Review Session.

Kate Milova MolGen retreat March 24, Microarray experiments. Database and Analysis Tools. Kate Milova cDNA Microarray Facility March 24, 2005.

Zachary Bendiks. Jonathan Eisen  UC Davis Genome Center  Lab focus: “Our work focuses on genomic basis for the origin of novelty in microorganisms (how.

341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London

Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry.

Computer Science Graduate Studies in U of Memphis.

Integrating Bioinformatics into the Life Sciences – Phase 2 Mark Pauley and Bill Tapprich Group #2: Integration.

Accurate estimation of microbial communities using 16S tags Julien Tremblay, PhD

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Alignment methods April 26, 2011 Return Quiz 1 today Return homework #4 today. Next homework due Tues, May 3 Learning objectives- Understand the Smith-Waterman.

Interactive tools and programming environments for sequence analysis Bernardo Barbiellini Northeastern University TATACATAAAGACCCAAATGGAACTGTTCTAGA TGATACACTAGCATTAAGAGAAAAATTCGAAGA.

Scoring Matrices April 23, 2009 Learning objectives- 1) Last word on Global Alignment 2) Understand how the Smith-Waterman algorithm can be applied to.

Automated Barcoding Using the Characteristic Attribute Organization System Indra Neil Sarkar, PhD Divisions of Invertebrate Zoology & Library Services.

Bioinformatics Education at North Central College Caroline St.Clair Professor of Computer Science.

Alignment, Part I Vasileios Hatzivassiloglou University of Texas at Dallas.

Bioinformatics: Theory and Practice – Striking a Balance (a plea for teaching, as well as doing, Bioinformatics) Practice (Molecular Biology) Theory: Central.

Introduction to Bioinformatics Biostatistics & Medical Informatics 576 Computer Sciences 576 Fall 2008 Colin Dewey Dept. of Biostatistics & Medical Informatics.

Construction of Substitution Matrices

Bioinformatics Multiple Alignment. Overview Introduction Multiple Alignments Global multiple alignment –Introduction –Scoring –Algorithms.

Identification of Ortholog Groups by OrthoMCL Protein sequences from organisms of interest All-against-all BLASTP Between Species: Reciprocal best similarity.

Overview of Bioinformatics 1 Module Denis Manley..

Evolution of BINF Bioinformatics Certificate Foothill College R. Cormia, L. English, K. Erickson.

Bioinformatics Curriculum Issues, goals, curriculum.

Jobs, Careers, Internships, Senior Projects and Research Computer Application Development K-12 education Industrial Training Bioinformatics Validation.

Biocomputation: Comparative Genomics Tanya Talkar Lolly Kruse Colleen O’Rourke.

The Microbiome and Metagenomics

Sequence Based Analysis Tutorial March 26, 2004 NIH Proteomics Workshop Lai-Su L. Yeh, Ph.D. Protein Science Team Lead Protein Information Resource at.

341- INTRODUCTION TO BIOINFORMATICS Overview of the Course Material 1.

Accurate estimation of microbial communities using 16S tags

Construction of Substitution matrices

Bioinformatics Computing 1 CMP 807 – Day 2 Kevin Galens.

Bioinformatics Chem 434 Dr. Nancy Warter-Perez Computer Engineering Dr. Jamil Momand Chemistry & Biochemistry.

Interdisciplinary Research Interests.

. Sequence Alignment Author:- Aya Osama Supervision:- Dr.Noha khalifa.

Last lecture summary. Sequence alignment What is sequence alignment Three flavors of sequence alignment Point mutations, indels.

Culturable Bacterial Communities Analyzer DIANA VANESSA SARRIA-ZUNIGA ELIANA TORRES-ZELADA April 29, 2016.

Date of download: 6/23/2016 Copyright © 2016 McGraw-Hill Education. All rights reserved. Pipeline for culture-independent studies of a microbiota. (A)

CISC667, S07, Lec25, Liao1 CISC 467/667 Intro to Bioinformatics (Spring 2007) Review Session.

Date of download: 7/7/2016 Copyright © 2016 McGraw-Hill Education. All rights reserved. Pipeline for culture-independent studies of a microbiota. (A) DNA.

Robert Edgar Independent scientist

Bioinformatics Overview

Introduction to Bioinformatics Resources for DNA Barcoding

Preprocessing Data Rob Schmieder.

Phylogeny - based on whole genome data

Seminar in Bioinformatics (236818)

Workshop on the analysis of microbial sequence data using ARB

Genome Annotation Continued

Overview Bioinformatics: Analyzing biological data using statistics, math modeling, and computer science BLAST = Basic Local Alignment Search Tool Input.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

CISC 667 Intro to Bioinformatics (Spring 2007) Review session for Mid-Term CISC667, S07, Lec14, Liao.

Independent scientist

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

BIOINFORMATICS PROGRAM St. Edward’s University Genomics Education Partnership (GEP) Genomics Consortium for Active Teaching (GCAT)

Curriculum Genomics Track (11-12hrs): Evolution Biochemistry I, II Cell, Micro, Neuro Genomics Track (11-12hrs): Evolution Biochemistry I, II Cell, Micro, Neuro Bio-Math Track Track (11-12hrs): Linear Algebra Differential Equation Prob/Theory Stats. Cell, Micro, Neuro Bio-Math Track Track (11-12hrs): Linear Algebra Differential Equation Prob/Theory Stats. Cell, Micro, Neuro Cells/Org. Sys. Organisms/Pop Gen. Chem Analytic Chem Calculus I Calculus II Intro BINF Y1 Molecular Organic I Java I Calculus III Discrete Java II Genomics Perl, Python, R Y2 Applied Stats Alg. & Data Struct. Alg. & Data Struct. Senior Seminar Research (3x) Bioinformatics Y3,4

Biological Programming Data structures: scalars, arrays, hashes Control Structures Blast: principles, parsing (BioPerl) Distance matrices: dissimilarity (Jaccard) Phylogenetic Profiles Protein conservation/annotation Phylogenetic Profiles

Bioinformatics Construct simple hidden Markov model Membrane Proteins: LILWLVIAVVLMSVFQSFGP PSLLASIFISWFPMLLLIGVWIFFM YFVIQTYLPCIMTVILSQVSFW Soluble Proteins: MAKN RQMQGGGGKGAMSFGKSKARMLTEDQI KTTFADVAGCDEAKEEVAELVEYLREPS RFQKLGGKIPKGVLMVGPPGTGKTLLAK AIAGEAKVPF State Sequences: >FTSH_ECOLI iiiiMMMMMMMMMMMMMMMMMMMMoooooooooooooooooooooooooooooo ooo oooooooooooooooooooooooooooooooooooMMMMMMMMMMMMMMMMMM MMM Iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii Other Projects: Smith-Waterman Multivariate Analysis (PCoA) RNASeq Analysis (Tophat/Bowtie)

Senior Research Projects

No Burn Light Burn High Burn Unweighted (rare species) Isolate DNA PCR 454 Sequencing Primer Sets 454 Sequencing Primer Sets Soil samples QIIME Sequence Filtering depleted of barcodes/ primers < 200 removed Ave. quality score <25 Ambiguous base calls Homopolymer runs (>6x) Chimeras depleted of barcodes/ primers < 200 removed Ave. quality score <25 Ambiguous base calls Homopolymer runs (>6x) Chimeras OTU Identification Clustering at 3% divergence (97% similarity) Clustering at 3% divergence (97% similarity) OTU Classification Sequences were aligned to the Silva database using the PyNAST algorithm (minimum percent identity was set at 80%)