Calculating branch lengths from distances. ABC A -----2040 B----- 44 C----- a b c.

Slides:

Advertisements

Similar presentations

Phylogenetic Tree A Phylogeny (Phylogenetic tree) or Evolutionary tree represents the evolutionary relationships among a set of organisms or groups of.

Advertisements

Bioinformatics Phylogenetic analysis and sequence alignment The concept of evolutionary tree Types of phylogenetic trees Measurements of genetic distances.

An Introduction to Phylogenetic Methods

Lecture 3 Molecular Evolution and Phylogeny. Facts on the molecular basis of life Every life forms is genome based Genomes evolves There are large numbers.

1 General Phylogenetics Points that will be covered in this presentation Tree TerminologyTree Terminology General Points About Phylogenetic TreesGeneral.

Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.

Phylogenetics - Distance-Based Methods CIS 667 March 11, 2204.

Summer Bioinformatics Workshop 2008 Comparative Genomics and Phylogenetics Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State.

Phylogenetic reconstruction

Phylogenetic trees Sushmita Roy BMI/CS 576 Sep 23 rd, 2014.

Molecular Evolution Revised 29/12/06

Tree Reconstruction.

Bioinformatics and Phylogenetic Analysis

In addition to maximum parsimony (MP) and likelihood methods, pairwise distance methods form the third large group of methods to infer evolutionary trees.

Maximum Likelihood Flips usage of probability function A typical calculation: P(h|n,p) = C(h, n) * p h * (1-p) (n-h) The implied question: Given p of success.

Lecture 24 Inferring molecular phylogeny Distance methods

Molecular Evolution, Part 2 Everything you didn’t want to know… and more! Everything you didn’t want to know… and more!

Building Phylogenies Distance-Based Methods. Methods Distance-based Parsimony Maximum likelihood.

Phylogenetic Analysis. 2 Phylogenetic Analysis Overview Insight into evolutionary relationships Inferring or estimating these evolutionary relationships.

Parsimony methods the evolutionary tree to be preferred involves ‘the minimum amount of evolution’ Edwards & Cavalli-Sforza Reconstruct all evolutionary.

Phylogenetic trees Sushmita Roy BMI/CS 576

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.

Multiple Sequence Alignments and Phylogeny.  Within a protein sequence, some regions will be more conserved than others. As more conserved,

Phylogenetic analyses Kirsi Kostamo. The aim: To construct a visual representation (a tree) to describe the assumed evolution occurring between and among.

Phylogenetic Analysis. 2 Introduction Intension –Using powerful algorithms to reconstruct the evolutionary history of all know organisms. Phylogenetic.

Terminology of phylogenetic trees

Molecular phylogenetics

Molecular basis of evolution. Goal – to reconstruct the evolutionary history of all organisms in the form of phylogenetic trees. Classical approach: phylogenetic.

1 Dan Graur Molecular Phylogenetics Molecular phylogenetic approaches: 1. distance-matrix (based on distance measures) 2. character-state.

Phylogenetic Analysis. General comments on phylogenetics Phylogenetics is the branch of biology that deals with evolutionary relatedness Uses some measure.

Molecular phylogenetics 1 Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Sections

Computational Biology, Part D Phylogenetic Trees Ramamoorthi Ravi/Robert F. Murphy Copyright  2000, All rights reserved.

BINF6201/8201 Molecular phylogenetic methods

Bioinformatics 2011 Molecular Evolution Revised 29/12/06.

Applied Bioinformatics Week 8 Jens Allmer. Practice I.

OUTLINE Phylogeny UPGMA Neighbor Joining Method Phylogeny Understanding life through time, over long periods of past time, the connections between all.

Phylogenetic Trees  Importance of phylogenetic trees  What is the phylogenetic analysis  Example of cladistics  Assumptions in cladistics  Frequently.

Chapter 8 Molecular Phylogenetics: Measuring Evolution.

Building phylogenetic trees. Contents Phylogeny Phylogenetic trees How to make a phylogenetic tree from pairwise distances  UPGMA method (+ an example)

Introduction to Phylogenetics

MOLECULAR PHYLOGENETICS Four main families of molecular phylogenetic methods :  Parsimony  Distance methods  Maximum likelihood methods  Bayesian methods.

Construction of Substitution Matrices

Classwork II: NJ tree using MEGA. 1.Go to CDD webpage and retrieve alignment of cd00157 in FASTA format. 2.Import this alignment into MEGA and convert.

Molecular Phylogeny. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.

Phylogeny Ch. 7 & 8.

Applied Bioinformatics Week 8 Jens Allmer. Theory I.

Construction of Substitution matrices

Ayesha M.Khan Spring Phylogenetic Basics 2 One central field in biology is to infer the relation between species. Do they possess a common ancestor?

1 CAP5510 – Bioinformatics Phylogeny Tamer Kahveci CISE Department University of Florida.

Ch. 26 Phylogeny and the Tree of Life. Opening Discussion: Is this basic “tree of life” a fact? If so, why? If not, what is it?

Fitch-Margoliash Algorithm 1.From the distance matrix find the closest pair, e.g., A & B 2.Treat the rest of the sequences as a single composite sequence.

CSCE555 Bioinformatics Lecture 13 Phylogenetics II Meeting: MW 4:00PM-5:15PM SWGN2A21 Instructor: Dr. Jianjun Hu Course page:

Building Phylogenies. Phylogenetic (evolutionary) trees Human Gorilla Chimp Gibbon Orangutan Describe evolutionary relationships between species Cannot.

Molecular Evolution. Study of how genes and proteins evolve and how are organisms related based on their DNA sequence Molecular evolution therefore is.

Phylogenetic trees. 2 Phylogeny is the inference of evolutionary relationships. Traditionally, phylogeny relied on the comparison of morphological features.

Bioinformatics Overview

Introduction to Bioinformatics Resources for DNA Barcoding

Evolutionary genomics can now be applied beyond ‘model’ organisms

Phylogenetic basis of systematics

Inferring a phylogeny is an estimation procedure.

Goals of Phylogenetic Analysis

Molecular basis of evolution.

Patterns in Evolution I. Phylogenetic

Molecular Clocks Rose Hoberman.

Phylogenetic Trees.

Molecular Evolution.

Chapter 19 Molecular Phylogenetics

#30 - Phylogenetics Distance-Based Methods

Unit Genomic sequencing

Presentation transcript:

Calculating branch lengths from distances. ABC A B C----- a b c

1.1 Distance methods: Neighbor-joining method. NJ is based on minimum evolution principle (sum of branch length should be minimized). Given the distance matrix between all sequences, NJ joins sequences in a tree so that to give the estimate of branch lengths. 1.Starts with the star tree, calculates the sum of branch lengths. A B C D E a bc d e

1.2 Neighbor-joining method. 2. Combine two sequences in a pair, modify the tree. Recalculate the sum of branch lengths, S for each possible pair, choose the lowest S. A B C D E a b c d e 3. Treat cluster CDE as one sequence “X”, calculate average distances between “A” and “X”, “B” and “X”, calculate “a” and “b”. 4. Treat AB as a single sequence, recalculate the distance matrix. 5. Repeat the cycle and calculate the next pair of branch lengths.

2.1 Maximum parsimony: definition of informative sites. Maximum parsimony tree – tree, that requires the smallest number of evolutionary changes to explain the differences between external nodes. Site, which favors some trees over the others A A G A C T G A G C C C T G A G A T T T C A G A G T T C * * Site is informative if there are at least two different kinds of letters at the site, each of which is represented in at least two of the sequences.

2.2 Maximum parsimony. 1.G 2.C GA 3.A 4.A A 1.G 3.A A 2.C 4.A 1.G 4.A AA 2.C 3.A Tree 1.Tree 2.Tree 3. Site 3 Site 3 is not informative, all trees are realized by the same number of substitutions. Advantage: deals with characters, don’t need to compute distance matrices. Disadvantage: - multiple substitutions are not considered - branch lengths are difficult to calculate - slow

2.3 Maximum parsimony method. 1.Identify all informative sites in the alignment. 2. Calculate the minimum number of substitutions at each informative site. 3. Sum number of changes over all informative sites for each tree. 4. Choose tree with the smallest number of changes.

Maximum likelihood methods. Similarity with maximum parsimony: - for each column of the alignment all possible trees are calculated - trees with the least number of substitutions are more likely Advantage of maximum likelihood over maximum parsimony: - takes into account different rates of substitution between different amino acids and/or different sites - applicable to more diverse sequences

Molecular clock. First observation: rates of amino acid substitutions in hemoglobin and cytochrome c are ~ the same among different mammalian lineages. Molecular clock hypothesis: rate of evolution is ~ constant over time in different lineages; proteins evolve at constant rates. This hypothesis is used in estimating divergence times and reconstruction of phylogenetic trees.

Estimation of species divergence time. Assumption: rate constancy, molecular clock. Find T 1 if T 2 is known. ABC T1T1 T2T2

Classwork: phylogeny of humans and apes. HumanChimpan zee GorillaOrangutanRhesus monkey Human Chimpanzee1.45 Gorilla Orangutan Rhesus monkey

Fixation of mutations. Not all mutations are spread through population. Fixation – when a mutation is incorporated into a genome of species. Fixation rate will depend on the size of population (N), fitness (s) and mutation rate (μ):

Neutral theory of evolution. Kimura in 1968: majority of molecular changes in evolution are due to the random fixation of neutral mutations (do not effect the fitness of organism. As a consequence the random genetic drift occurs. Value of selective advantage of mutation should be stronger than effect of random drift.

Classwork: maximum marsimony. 1.Search the NCBI Conserved Domain Database for pfam Construct maximum parsimony tree using MEGA3. 3.Analyze this tree and compare it with the phylogenetic tree from the research paper.