Now on Bio308 Translation: Converting the blueprint into a working model 36” 72’ Grade P red oak, inlay mahaog.

Slides:

Advertisements

Similar presentations

Transcription and Translation

Advertisements

Gene Expression and Control Part 2

Cell Division, Genetics, Molecular Biology

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

Gene Expression Overview

2.7 DNA Replication, transcription and translation

13.3: RNA and Gene Expression

Nucleic Acids 7.3 Translation.

Transcription & Translation

Protein Synthesis Mrs. Harlin.

Chapter 14 Translation.

Gene Structure and Function

From Gene to Protein. Gene Expression Process by which DNA directs the synthesis of a protein 2 stages transcription translation All organisms One gene.

Gene Action Protein Synthesis.

Protein Translation From Gene to Protein Honors Biology Ms. Kim.

Biology 10.1 How Proteins are Made:

Previously: Getting things made Now: getting them where they need to go: Protein Targeting Translation: Converting nucleotide sequence to amino acid chain.

Hemophilia- Caused by a defect in a single gene cannot produce all the proteins necessary for blood clotting Depend on expensive injections of clotting.

Gene Expression and Control

Previously and then some Transcription basics: DNA structure, Parts of a eukaryotic gene, initiation, elongation, termination 1) If the DNA in every cell.

Translation Protein Biosynthesis. Central Dogma DNA RNA protein transcription translation.

Protein Synthesis: Ch 17 From : Kevin Brown – University of Florida

General Biology Notes TRANSLATION A.K.A. PROTEIN SYNTHESIS

Protein Synthesis Translation. DNA (genes) information copied to make  mRNA (transcription) Information in mRNA sequence used to put together  Chain.

DNA Function: Information Transmission. ● DNA is called the “code of life.” What does it code for? *the information (“code”) to make proteins!

Chapter 7 Gene Expression and Control Part 2. Transcription: DNA to RNA  The same base-pairing rules that govern DNA replication also govern transcription.

DNA and Translation Gene: section of DNA that creates a specific protein Approx 25,000 human genes Proteins are used to build cells and tissue Protein.

Protein Synthesis: Translation. The Ribosome: Key Points Consists of 2 subunits Large Subunit (60S) Small Subunit (40S) mRNA is clamped by the subunits.

Transcription & TranslationNovember , 2012 W ARM U P … What are the differences between DNA & RNA?

Core Transcription and Translation

Leaving Cert Biology Genetics – section 2.5 Genetics ( RNA), 2.5.5,

8.5 Translation TEKS 4B, 6C The student is expected to: 4B investigate and explain cellular processes, including homeostasis, energy conversions, transport.

A process designed to create proteins..  What template is being used to create our protein sequence?  Where is translation taking place?  What types.

From DNA to Proteins Chapter 14. Marvelous Mussel Adhesive Marvelous Mussel Adhesive Mussel binds itself to rocks with threads coated with the protein.

Central Dogma – part 2 DNA RNA PROTEIN Translation Central Dogma

Copyright © 2006 Pearson Prentice Hall, Inc. Chapter 9 Gene Expression and Regulation.

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

TOPIC 2.7 TRANSCRIPTION & TRANSLATION. Nucleus: the control center  contains nuclear envelope, nucleoli, chromatin, and distinct compartments rich in.

Questions How does RNA polymerase work and what does it make? How does it know where to start and stop? How does a ribosome work and what does it make?

RNA processing and Translation. Eukaryotic cells modify RNA after transcription (RNA processing) During RNA processing, both ends of the primary transcript.

TRANSLATION. Cytoplasm Nucleus DNA Transcription RNA Translation Protein.

CHAPTER 10 “HOW PROTEINS ARE MADE”. Learning Targets  I will compare the structure of RNA with that of DNA.  I will summarize the process of transcription.

Lesson 4- Gene Expression PART 2 - TRANSLATION. Warm-Up Name 10 differences between DNA replication and transcription.

DRM Biology Y11 1 TRANSCRIPTION AND TRANSLATION From DNA to protein.

BIOL 2416 CH 6: Translation. What is a protein? A protein consists of 1 or more polypeptides A polypeptide is a polymer of amino acids bound together.

Gene Expression II. Translation Overview Conversion of triplet code into polypeptide Takes place at ribosome in cytoplasm Involves all 3 types of RNA.

Chapter 17: From Gene to Protein AP Biology Mrs. Ramon.

Section 20.2 Gene Expression

Translation – Protein Synthesis

Protein Synthesis Translation.

Protein Synthesis (Translation)

PROTEIN SYNTHESIS.

Amino acids (protein building blocks) are coded for by mRNA base sequences.

How to Make a Protein?.

Gene Expression: from DNA to protein

Reading the instructions and building a protein!

Protein Synthesis Ch 17.

Protein Synthesis.

Protein Synthesis – The Key Steps

10-3 Protein Synthesis Together, all 3 types of RNA synthesize proteins. Proteins are polymers. Polypeptides linked by peptide bonds. Made of 20 different.

Translation 2.7 & 7.3.

Protein Synthesis Step 2: Translation

copyright cmassengale

(Transcription & Translation)

Figure 17.1 Figure 17.1 How does a single faulty gene result in the dramatic appearance of an albino deer?

Steps of Translation.

An Overview of Gene Expression

LAST UNIT! Energetics.

Translation: Protein Synthesis

Presentation transcript:

Now on Bio308 Translation: Converting the blueprint into a working model 36” 72’ Grade P red oak, inlay mahaog

Previously on Bio308 Genes: definition and parts Nucleic Acids: DNA: basic parts, the bonds that link bases into strands the bonds that make strands into double helix RNA: basic parts and bonds differences between it and DNA types of RNA in the cell Transcription: Copying genetic information from DNA to mRNA what are the steps? (transcription and processing) where does it occur? why is it necessary?

Nucleotides to proteins: Step II Are cytosolic and integral membrane proteins transcribed the same way? Are they translated the same way? From nucleotides to amino acids---How? Three basic steps:InitiationElongationTermination Fig 4-26

Two adaptors used: tRNA and amino acyl tRNA-synthetases Codons, Anticodons, and Wobble ‘Charging’ of tRNA Basepairing with a tRNA Fig4-26 Using Inosine w/ A, U, or C Fig 4-28

That Degenerate Genetic code # codons > # tRNAs > # aminoacids How did they figure out the genetic code? Strings of identical nucleotides Nirenberg CCAGAGCAGACUGCUUAGCUUCAUCCCACGAACGGGAG P E Q T A STOP L H P T N G ? Q S R L L S F I P R T G R A D C L A S S H E R E

Initiation Players? How does the complex know where to start translating? In Bacteria? In eukaryotes? 3’ mRNA 5’ AAAAAAAA Initiation factors IFs Small subunit of ribosome Initiator tRNA Met Once initiation complex forms large subunit of ribosome is recruited

Elongation Players? mRNA Aminoacyl- tRNAs Elongation factors Ribosome Requires GTP hydrolysis Results in peptide bond formation Chain grows from N to C P site A site E site CBI 6.4 Translation

Termination Players? mRNA Termination factors Ribosome Fig 4-40 How does it work? Why does the chain end?

The Protein What happens to the protein? Folding Sorting What happens to the mRNA, the ribosomes and the tRNA? Reuse Polysomes

Translation, Bipolar Disorder, and …… What does this have to do with bipolar disorder? Synthesized in cytosol sorted/packaged into vesicles for use Tale of 2 proteins--- a stretched metaphor Many neurotransmitters are amino acids, amino acid derivatives (like dopamine), or short peptides How does the neurotransmitter packaging occur? Transporters found in cellular membranes Nobel Prize for Medicine 2000: Dopamine as a neurotransmitter and its role in brain dysfunctions (Dopamine is the catecholamine implicated in bipolar disorder)

Synaptic vesicles What are they? Vesicles are membrane spheres Neurotransmitters are polar How do they get in?