3/30 6.2 exit slip Protein Synthesis 6.3! HW finish worksheet Quiz 6.1

Transcription and Translation GENE TO PROTEIN

DNA determines your unique characteristics. A Review… DNA is the instructions for making proteins. Proteins play a big role in everything you do and determine most of your characteristics

Examples of Proteins Enzymes Connective Muscle Fibers Carrier Molecules Hormones Antibodies Membrane Channels Pigments Cytoskeleton

2 Stages Transcription Translation DNA → mRNA mRNA → Protein

mRNA? What’s that?

DNA → mRNA Uracil replaces Thymine DO NOT say A turns into U. A codes for U The DNA does not become or mutate into the RNA DNA nucleotide codes for RNA nucleotide Adenine (A) Uracil (U) Thymine (T) Guanine (G) Cytosine (C)

Transcription The enzyme RNA polymerase builds an RNA strand complementary to the DNA

The following diagram shows the strands of DNA unwinding and RNA nucleotides being added…

This diagram just shows how the RNA strand breaks off from the DNA template…

Where Does Transcription Begin? At the promoter (for our simulations the TATAA box) Proteins called transcription factors help RNA Polymerase bind to the DNA

Prokaryotes vs. Eukaryotes No nucleus Transcription and translation happen relatively simultaneously Transcription in nucleus mRNA edited before translation (beyond our scope) mRNA leaves nucleus for translation

Translation The mRNA serves as instructions for assembling a protein

How? The sequence of mRNA nucleotides determines the order of amino acids in the protein Every 3 nucleotides (codon) codes for one amino acid

So the process basically works like this….

Remember Amino Acids?

Order of Amino Acids Determine Protein Structure Due to Side Chains

Translation Details Occurs in the ribosome in both prokaryotes and eukaryotes mRNA brings the code from transcription tRNA carries in amino acids one by one Protein is assembled

How Does the tRNA “know” Which Amino Acid to Bring? The anticodon on the tRNA is complementary to the codon on the mRNA Hydrogen bonds

More Realistic View

The Start and Stop Codons Start Codon Stop Codon Begins translation Always AUG So Met is always the first amino acid DOES NOT code for an amino acid Stops translation

You can determine which amino acid is coded for by each codon by looking at the following table: *Note: there is one codon (AUG) that is the start codon – this is present at the beginning of each gene that codes for a different protein. Also, there are 3 stop codons that do not code for any amino acid but signal the end of a gene.

1. mRNA attaches to a RIBOSOME at start codon

The process continues until a stop codon is reached. The protein is then released from the ribosome.

To make the process of translation faster and to make many copies of a protein, multiple ribosomes can move along mRNA at once looking something like this…

Figure: 14-11b Title: Mass Production Caption: (b) A micrograph of this process in operation. The figure shows two mRNA strands with ribosomes spaced along their length. In the upper strand, translation is under way and polypeptides can be seen emerging from the ribosomes.

Review DNA: AGCGCTATAAGCTACGCGCAGCATT mRNA: CGAUGGCGUCGUAA tRNA: UACCGCAGC Protein Met-Arg-Ser Review Promoter Stop Codon Start Codon

Figure: 14-11b Title: Mass Production Caption: (b) A micrograph of this process in operation. The figure shows two mRNA strands with ribosomes spaced along their length. In the upper strand, translation is under way and polypeptides can be seen emerging from the ribosomes.

Rapid Review Transcription makes mRNA based on the DNA Occurs in nucleus Begins at promoter Translation assembles protein based on mRNA code With help of tRNA in ribosome Begins at start codon. Ends at stop codon The structure and shape of the protein depends on the DNA sequence

Keep in mind… Genes don’t code for traits They code for proteins (or parts of proteins) that can affect traits i.e. they can code for a protein that makes eyes brown Differences in DNA determine differences in proteins = differences in physical traits.

Transcription Animation http://www.hhmi.org/biointeractive/dna/DNAi_transcription_vo2.html

Basic Translation Animation http://www.youtube.com/watch?v=1PSwhTGFMxs http://www.hhmi.org/biointeractive/dna/DNAi_tra nslation_vo1.html http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf   http://vcell.ndsu.nodak.edu/animations/

Detailed Translation Animation http://www.hhmi.org/biointeractive/dna/DNAi_translation_vo2.html http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html# http://www.wisc-online.com/objects/index_tj.asp?objid=AP1302