DNA and Protein Synthesis

Protein Synthesis It’s a process –DNA -> RNA -> Amino Acids (Protein)

RNA Sugar is Ribose NOT what… Has nitrogen base Uracil instead of Thymine –Also contains the other 3 bases…what are they? Only single stranded

RNA

Three processes in this unit… 1. Replication (DNA  DNA) 2. Transcription (DNA  mRNA) 3. Translation (RNA  Protein)

A. DNA Replication 1.Occurs in the nucleus prior to any cell division 2.Enzyme is used to “unzip” or “unwind” the DNA a.Forms a bubble at the origin site

DNA Replication (cont.) 3.Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA a.Nitrogenous bases pair up 1.A – T 2.C - G 4.As a result, you create two identical strands of DNA

Let’s Practice Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

Let’s Build A Protein

Transcription 1.) DNA strand unzips –The bonds between the nitrogen bases are broken –Initiated by RNA polymerase (enzyme) binding to promoter site on DNA 2.) A single strand of mRNA (messenger RNA) is made –Pair up the bases A  T  C  G  The mRNA then travels from nucleus to cytoplasm

Transcription

Where in the cell does transcription take place? 1.Cytoplasm 2.Mitochondria 3.Nucleus 4.Golgi Body 5.Vacuole

Any given segment of DNA has directions that make unique what? 1.Glucose 2.Proteins 3.Lipids 4.Blood cells

If a DNA strand has the following sequence of base pairs – A C T G G T C C A A, then the mRNA strand would have what sequence? 1.T G A C C A G G T T 2.A C T G G T C C A A 3.T G U C C U G G T T 4.U G A C C A G G U U

Why is mRNA called messenger RNA? Because it carries the directions to make a protein to the ribosome like a message

Actually 3 types of RNA mRNA- messenger –Brings message from nucleus to ribosomes in cytoplasm rRNA- ribosomal –Make up a ribosome tRNA- transfer –“transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

The difference between RNA and DNA is what? 1.The phosphates 2.The sugars 3.The nitrogen bases 4.The way the monomer units bond

mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? 1.Mitochondria 2.Ribosome 3.Golgi Body 4.Lysosome 5.Nucleus

Translation 1. mRNA meets up with a ribosome…why?? –Ribosomes are the site for protein production 2. tRNA molecules bring amino acids to ribosomes 3. An mRNA codon will pair with a tRNA anticodon –Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid –Anticodon: 3 Nitrogen base sequence in tRNA

Translation (cont.) 4.As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

That’s the process, Now how do you know what amino acids make up a particular protein We use an mRNA codon chart

Where in the cell does transcription, the first part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Ribosomes 4.Cytoplasm

DNA has the directions to make what? 1.Glucose 2.Nucleotides 3.Proteins 4.Monosaccharides

After a strand of mRNA is made where does it go? 1.Ribosome 2.Mitochondria 3.Lysosome 4.Vacuole

Where in the cell does translation, the second part of protein synthesis, take place? 1.Mitochondria 2.Nucleus 3.Golgi body 4.Cytoplasm

Molecules called tRNA’s are floating around the cytoplasm carrying what? 1.mRNA’s 2.Glucose 3.DNA 4.Nucleotides 5.Amino Acids

An mRNA codon is made up of how many nitrogen bases?

Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? 1.Phenylalanine 2.Glutamine 3.Asparagine 4.Lysine 5.Tyrosine

What protein would be synthesized from the following mRNA strand? A C U U U C G A A U A C 1.Threonine – phenylalanine – glutamate – tyrosine 2.Phenylalanine – leucine – methionine – valine 3.Tyrosine – glutamate – phenylalanine – threonine 4.Lysine – cysteine – arginine – histidine

What protein would be synthesized from the following DNA segment? T A A G T A C G C T A G 1.Isoleucine – alanine – histidine – alanine 2.Isoleucine – histidine – alanine – isoleucine 3.Phenylalanine – leucine – valine – arginine 4.Isoleucine – leucine – threonine – lysine

How would you assess your comprehension of DNA and Protein Synthesis? 1.A 2.B 3.C 4.D