Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine ATGCCTAAGTACCGTA

Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine Shaped like a twisted ladder –Double Helix Career Spotlight! Molecular Geneticists study the structure of DNA involved in different diseases

Salk Institute Mobile Lab What does DNA do? Your DNA determines your PHENOTYPE –Instruction book for your cells My DNA Each instruction is called a GENE Genes are the recipes for Proteins All your genes together is called your GENOME How your cells read your Genome depends in part on your (and your cells’) environment

Salk Institute Mobile Lab Reading DNA PORFAVORNOHABLECUANDO ESTOYHABLANDO. ATACGGGCTAGCCTGACGTCA GTTTAAAAGCCCTG.

Salk Institute Mobile Lab TGACGTAAAGCTTGACCTAPUT A HAT ON YOUR HEAD PUT A BAT ON YOUR HEADTGACATAAAGCTTGACCTAPUT A BAT ON YOUR HEAD MUTATION! Reading DNA MUTATIONS are changes in your GENES that may be inherited –Even small changes in DNA can have big effects –Human DNA is ALL >99% identical! Career Spotlight! Genetic Counselors help people figure out if they might pass a disease mutation to their future children

Salk Institute Mobile Lab Where is DNA? DNA is found in the cells of every living organism –There are different types of cells Animal cells Plant cells Bacteria cells } DNA found in nucleus (Eukaryotic) - DNA floating loose (Prokaryotic)

Salk Institute Mobile Lab What color is DNA?