Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine.

Slides:



Advertisements
Similar presentations
DNA Notes.
Advertisements

Chapter 6: Genes and DNA Standard S7L3: Recognize how biological traits are passed on to successive generations.
Quiz Tomorrow- DNA Vocabulary – 10 pts fill-in w/ wordbank (Words from today’s notes not included) nucleus DNA Gene Chromosome Backbone Base Adenine Guanine.
UNIT 4 BIOLOGY Continuity and Change: Genetics and Evolution.
Genetics Jeopardy Q $100 Q $200 Q $300 Q $400 Q $500 Q $100 Q $200 Q $300 Q $400 Q $500 Final Jeopardy Bases Climbing the Ladder Genetics! Nice Genes!
DNA, Chromosomes & Genes. GENOME The nucleus of a human cell contains between and genes. This complete set of genes is called the GENOME.
DNA, Chromosomes & Genes. GENOME The nucleus of a human cell contains between and genes. This complete set of genes is called the GENOME.
DNA Replication.
DNA Structure Review. Questions 1.Name the term used to describe the shape of the DNA molecule. 2.What does DNA stand for? 3.What 3 chemicals make up.
DNA DNA is often called the blueprint of life.
Structure and Function
Structure and Function
CHAPTER 11 relating the structure of DNA to its function the role of DNA in protein production distinguish amongst different types of mutations.
National 5 Biology Course Notes Part 4 : DNA and production of
DNA.
DNA & Chromosomes. DNA Model DNA can be compared to a ladder that is twisted into a continuous spiral shape known as a double helix Each step contains.
DNA.
DNA and Genetics. The Structure of DNA Chromosomes are made of DNA. Each chromosome contains thousands of genes. The sequence of bases in a gene forms.
Discussion Questions - DNA Build It Lab 1.Backbone is made up of phosphate and deoxyribose sugar.
__________ = passing on of characteristics from parents to offspring How?... _____ HEREDITY DNA!
Have Your DNA and Eat It Too I will be able to describe the structure of the DNA molecule I will be able to explain the rules of base pairing I will understand.
DNA (Deoxyribonucleic Acid) DNA DNA.DNA - the blueprint of life. DNA contains the instructions for making proteins within the cell.
The Genetic Material DNA can be found in the nucleus of eukaryotic (animals, plants, some single celled organisms) cells, and in the cytoplasm of prokaryotes.
Structure Notes Mapping of Concept DNA Replication DNA Location Structure.
DNA, RNA & Protein Synthesis. A. DNA and the Genetic Code 1. DNA controls the production of proteins by the order of the nucleotides.
DNA Deoxyribonucleic Acid “living code”. DNA The genetic material of a cell contains information for the cell’s growth and other activities.
Genetic Information How are chromosomes, genes and DNA related? What are their roles as repositories or “keepers & transmitters” of genetic information?
DNA genetic material- all your genes instructions for all the information necessary for an organism to grow and live found in the nucleus in eukaryotes.
DNA – Show Me What You’re Made of!!
DNA Structure Deoxyribonucleic Acid pp Location  Prokaryotes: floats in cytoplasm  Eukaryotes: wrapped around proteins in the nucleus.
DNA and RNA Structure and Function Chapter 12 DNA DEOXYRIBONUCLEIC ACID Section 12-1.
DNA
BRAINSTORM In your group, brainstorm all your ideas about DNA. Include What is DNA? Where is DNA found? What is its function? Start Timer
DNA © 2014 Katie Garcia.
DNA Deoxyribonucleic Acid
DNA, Chromosomes & Genes
Mrs. Wharton’s Science Class
The DNA Connection.
DNA. Is often called the blueprint of life It contains the instruction for making proteins in the cell.
DNA, Chromosomes & Genes
DNA: The Molecule of Life
The DNA Connection.
How does genetic information become traits we can observe?
DNA, Chromosomes & Genes
What is the structure and function of DNA?
Cells, Chromosomes, DNA and RNA
DNA Standard: Students will recognize how biological traits are passed on to successive generations.
That stands for: DEOXYRIBONUCLEIC ACID
MODERN GENETICS DNA.
DNA, Chromosomes & Genes
GENETICS (Geneology) the study of “genes” Inheritable traits that
The Salk Mobile Science Lab Welcome Back!
What is the structure and function of DNA?
I. DNA.
Deoxyribonucleic Acid
DNA, Chromosomes & Genes
The DNA Connection.
DNA Vocabulary.
DNA Structure.
DNA.
DNA Notes.
Unit 4 Inheritance of Traits
Discovering
DNA, Chromosomes & Genes
What is DNA? Deoxyribo-Nucleic Acid
CHAPTER 4C….. Genes and DNA.
Notes – Genetics 1.
DNA and Genetics What is DNA?
Presentation transcript:

Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine ATGCCTAAGTACCGTA

Salk Institute Mobile Lab What is DNA? Deoxyribo-Nucleic Acid Long molecule made of different chemicals called Adenine, Thymine, Guanine, and Cytosine Shaped like a twisted ladder –Double Helix Career Spotlight! Molecular Geneticists study the structure of DNA involved in different diseases

Salk Institute Mobile Lab What does DNA do? Your DNA determines your PHENOTYPE –Instruction book for your cells My DNA Each instruction is called a GENE Genes are the recipes for Proteins All your genes together is called your GENOME How your cells read your Genome depends in part on your (and your cells’) environment

Salk Institute Mobile Lab Reading DNA PORFAVORNOHABLECUANDO ESTOYHABLANDO. ATACGGGCTAGCCTGACGTCA GTTTAAAAGCCCTG.

Salk Institute Mobile Lab TGACGTAAAGCTTGACCTAPUT A HAT ON YOUR HEAD PUT A BAT ON YOUR HEADTGACATAAAGCTTGACCTAPUT A BAT ON YOUR HEAD MUTATION! Reading DNA MUTATIONS are changes in your GENES that may be inherited –Even small changes in DNA can have big effects –Human DNA is ALL >99% identical! Career Spotlight! Genetic Counselors help people figure out if they might pass a disease mutation to their future children

Salk Institute Mobile Lab Where is DNA? DNA is found in the cells of every living organism –There are different types of cells Animal cells Plant cells Bacteria cells } DNA found in nucleus (Eukaryotic) - DNA floating loose (Prokaryotic)

Salk Institute Mobile Lab What color is DNA?