Donations Requested We could use some… Gummy Bears (we need lots of these)Gummy Bears (we need lots of these) Red TwizzlersRed Twizzlers Black TwizzlersBlack Twizzlers Why? Well…we are going to be making models of… DNA! Why? Well…we are going to be making models of… DNA! What is that…here we go 

Genetics The study of heredity…whatever that means. Heredity-The passing of traits from parents to progeny (offspring)

DNA 1.It’s a nucleic Acid…specifically it’s D eoxyribo n ucleic A cid. 2. This is the substance (it’s a molecule) that determines inherited characteristics. What’s that mean…to a human! Inherited…means it you get it from mom and dad. A characteristic is something like…eye color, the shape of your face…your blood type.

The Parts of DNA DNA is made up of NUCLEOTIDESDNA is made up of NUCLEOTIDES NUCLEOTIDES are made of three parts:NUCLEOTIDES are made of three parts: 1.A Pentose Sugar: Deoxyribose…it’s a sugar with 5 carbons (penta=5, -ose=sugar). 2.A Phosphate Group…that’s a compound with a PO 4 group. 3.One of four different Nitrogenous Bases: Adenine Thymine Cytosine Guanine A T C G

The Structure of DNA The DNA molecule looks like a ladder that has been twisted.The DNA molecule looks like a ladder that has been twisted. This shape is called a DOUBLE HELIX.This shape is called a DOUBLE HELIX Irwin Chargaff figures out that there is always the same amount of adenine as thymine, and there was the same amount of cytosine as guanine…smart human I gotta say.1950 Irwin Chargaff figures out that there is always the same amount of adenine as thymine, and there was the same amount of cytosine as guanine…smart human I gotta say.

*Extremely smart dudes/dudettes warning* 1.Rosalind Franklin: used X-ray diffraction to determine that the DNA molecule was a spiral. 2.James Watson & Francis Crick: figured out that the spiral was a double helix (TWO spirals…a twisted ladder) and made a model. Let’s see you use the properties of high energy electromagnetic waves to discover the shape of an organic macromolecule …yeah…that’s what I thought. Let’s see you use the properties of high energy electromagnetic waves to discover the shape of an organic macromolecule …yeah…that’s what I thought.

The Structure of the Double Helix The Rails of the ladder are alternating molecules of sugars and phosphates.The Rails of the ladder are alternating molecules of sugars and phosphates. The Rungs of the ladder are the nitrogen (nitrogenous) bases that are attached to the sugars.The Rungs of the ladder are the nitrogen (nitrogenous) bases that are attached to the sugars.

Here’s What it Looks Like

Here’s Where it Fits in With Cells…and YOU!

Here’s Another View…

Genes are… A GENE is a set of chemical instructions for assembling a protein. DNA is the molecule that carries these genetic instructions.A GENE is a set of chemical instructions for assembling a protein. DNA is the molecule that carries these genetic instructions. Within a gene, each group of three nitrogenous bases codes for one amino acid.Within a gene, each group of three nitrogenous bases codes for one amino acid. A sequence of amino acids is linked to make a protein.A sequence of amino acids is linked to make a protein. Proteins are fundamental to the function of cells and the expression of traits.Proteins are fundamental to the function of cells and the expression of traits.

Here’s The Relationship To Chromosomes

Replication When DNA copies (every time a cell divides), it splits down the middle separating in between the base pairs.When DNA copies (every time a cell divides), it splits down the middle separating in between the base pairs. The new strand of bases is complimentary…that means that where there’s an A (adenine), there will be a T (thymine) to match with it. Where there is a C (cytosine), there will be a G (guanine) to match with it.The new strand of bases is complimentary…that means that where there’s an A (adenine), there will be a T (thymine) to match with it. Where there is a C (cytosine), there will be a G (guanine) to match with it. Write the complimentary strand for this sequence: GAATTCGCGGATWrite the complimentary strand for this sequence: GAATTCGCGGAT

Here’s What You Should Have Here’s What You Should Have GAATTCGCGGATCTTAAGCGCCTA

Enzymes (an enzyme is a protein…look for the –ase) *There are a number of enzymes that are involved in this process:*There are a number of enzymes that are involved in this process: –DNA helicase: unzips the DNA –DNA polymerase: lines up the new bases –DNA ligase: “glues” sections together *Bonus info…no extra charge, and no…you don’t need to know it. But some day…

Genetic Engineering By understanding DNA we can…you tell me…it’s in your bookBy understanding DNA we can…you tell me…it’s in your book