Genetics Mitosis Semi-conservative Replication Protein Synthesis

Basic Unit of Life Cells Made of – outside (cell membrane) – Inside (cytoplasm and organelles) Governed by genetic material (DNA) – DNA wrapped in a membrane = nucleus Characteristic of EUKARYOTIC cells (plants, animals, fungi, protists, etc) – DNA loose in cytoplasm = nucleoid region Characteristic of PROKARYOTIC CELLS (Bacteria)

Are their cells different?

Cell Size Cells cannot grow to unlimited size Nucleus cannot control movement into and out of cell membrane Not enough of assorted organelles to get necessary work done (proteins made, waste removed, etc.) Key is surface area to volume ratio

Fill in the data chart S = width of one side S 2 = surface area of one side X 6 = total surface area S 3 = volume Surface area to volume ratio

Cells divide so they don’t get too big. Requires copies of all cell contents including DNA DNA copies by semi-conservative replication. – Each strand is half old and half new. MITOSIS: Basic cell division for growth and repair. – Interphase (G1, S and G2) – M phase: Prophase, Metaphase, Anaphase, and Telophase … – followed by Cytokinesis – Results in two “daughter” cells

DNA Song We love DNA made of nucleotides – Really, what’s a nucleotide made of Sugar, phosphate and a base bonded down one side – What are the bases? Adenine and thymine make a lovely pair Cytosine without guanine would seem very bare Oh, de-ox-y-ri-bo-nu-cleic acid RNA is ri-bo-nu-cleic acid

DNA Replication DNA must be copied so every new cell has the same number and same kind of chromosomes as every other cell.

Semiconservative Replication Strands separate Bases are added New DNA is half old, half new

Protein Synthesis DNA directs cell process through the production of proteins – Proteins are used for muscles, hormones, enzymes, etc. Protein “synthesis” means to make a protein Occurs in two steps – 1) transcription: occurs in nucleus – 2) translation: occurs in cytoplasm at ribosome

Transcription DNA unzips Nucleotides are added to form a “messenger” RNA molecule (mRNA) mRNA leaves nucleus through nuclear pore

Translation Messenger RNA travels to ribosome Three bases sequences on RNA are called codons – Ex: AAC GUA AAC GCC AUC Transfer RNA molecules (tRNA) bring amino acids to ribosome that match the codon on the mRNA.

AGCUCUGCCAAACAGUCUGUACAAGGUUAA