Analysis of C282Y mutation in hemochromatosis gene

PCR – mutation C282Y (hemochromatosis) MIX – per 1 sample 15,8 ul H2O 2,5 ul buffer 1,5 ul primer 1 (P1) 1,5 ul primer 2 (P2) 2,0 ul MgCl2 0,5 ul dNTP 1,0 ul DNA 0,2 ul Taq polymerasis (add on ice)

PCR – mutation C282Y - ELFO

RFLP –Restriction Fragment Length Polymorphism restriction analysis of DNA by its digestion with restriction endonucleases (RE) in specific restriction sites in the case the sequence difference (polymorphism) creates or disturbs a specific site for RE, after restriction, fragments with different sizes are formed

RFLP –Restriction Fragment Length Polymorphism restriction analysis of DNA by its digestion with restriction endonucleases (RE) in specific restriction sites in the case the sequence difference (polymorphism) creates or disturbs a specific site for RE, after restriction, fragments with different sizes are formed

RFLP –Restriction Fragment Length Polymorphism Restriction endonucleases (RE) known about 2100 bacterial RE RE recognize variously short nucleotides sequences (4,6,8), in which then they digest covalent phosphodiester bonds Principle of the analysis starting DNA (genomic DNA, PCR product) digestion with a restriction enzyme into fragments with different sizes fragments electrophoresis separation

Sequence of C282Y mutation (hemochromatosis) 5´- TGGCAAGGGTAAACAGATCCctctcctcatccttcctctttcctgtcaagtgccctcctttggtgaaggtgacacatcatgtgacctcttca gtgaccacactacggtgtcgggccttgaactactacccccagaacatcaccatgaagtggctgaaggataagcagccaatggatgccaaggagttcgaac ctaaagacgtattgcccaatggggatgggacctaccagggctggataaccttggctGTACcccctggggaagagcagagatatacGTGCcaggtgg agcacccaggcctggatcagcccctcattgtgatctggggtatgtgactgatgagagccaggagctgagaaaatctattgggGGTTGAGAGGAGTGC CTGAGgaggtaattatggcagtgagatgaggatctgctctttgttagggggtgggctgagggtggcaatcaaaggctttaacttgctttttctgttttagagccctca ccgtctggcaccctagtcattggagtcatcagtgga – 3´ Primers restriction endonucleasis RsaI restriction site (GTAC) mutation C282Y (GTGC → GTAC)

RFLP – mutation C282Y (hemochromatosis) MIX – per 1 sample 7,0 ul H2O 2,0 ul buffer 10 ul PCR product 1,0 restriction endonukleasis RsaI (add on ice) Incubation 37°C 2 h

RFLP – mutation C282Y - ELFO

Hemochromatosis autosomal recessive disease affecting iron metabolism excessive iron absorption, its deposition in organs (mainly parenchymal) and subsequent damage of the organism hepatopathy (cirrhosis, hepatocellular carcinoma) diabetes mellitus, arthropathy, hypogonadism, kardiomyopathy, amenorhea serum iron, transferrin saturation, ferritin, liver biopsy repeated phlebotomy

HFE gene mutations