DNA / RNA. tRNA rRNA mRNA 5’ 3’ Types of RNA Transcription: transfer of information from DNA to RNA in the nucleus  In the process of transcription.

Slides:

Advertisements

Similar presentations

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

Advertisements

Cell Division, Genetics, Molecular Biology

Nucleic Acids and Protein Synthesis

Cell Division, Genetics, Molecular Biology

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

RNA Transcription.

Translation (Protein Synthesis) RNA  protein. Making a protein Many RNAs needed –mRNA, tRNA, rRNA.

The Three T’s 1. Transcription 2. Translation 3. Termination

From gene to protein. DNA:nucleotides are the monomers Proteins: amino acids are the monomers DNA:in the nucleus Proteins:synthesized in cytoplasm.

8.4 DNA Transcription 8.5 Translation

Section 2 From DNA to Protein

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Protein Synthesis Using RNA to make proteins. Going from DNA to Proteins Let’s review what we’ve done so far: We take our DNA and convert it into RNA.

Chapter 13.2 Ribosomes and Protein Synthesis

Making Proteins From DNA to Protein. What is transcription? Transcription = The process of making RNA from DNA’s instructions.

Chapter 13: RNA and Protein Synthesis

RNA and protein synthesis. RNA Single strand of nucleotides Sugar is ribose Uracil instead of thymine.

DNA to Proteins 3-4.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

GENE EXPRESSION TRANSCRIPTION, TRANSLATION AND MUTATIONS.

General Biology Notes TRANSLATION A.K.A. PROTEIN SYNTHESIS

Protein Synthesis Translation. DNA (genes) information copied to make  mRNA (transcription) Information in mRNA sequence used to put together  Chain.

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Transcription and Translation.  Genes: are segments of DNA that code for proteins  Most nucleotide base sequences in DNA don’t code for anything  ATGCGAATCGTAGCATACGATGCATGCACGTG.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

RNA AND PROTEIN SYNTHESIS

RNA Another Nucleic Acid.

Protein Synthesis.

Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.

Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.

The Genetic Code and Translation. Codon – three mRNA bases in a row that code for an amino acid Divide this mRNA strand into codons: AUGGGCACUCUCGCAUGA.

Structure of DNA DNA is made up of a long chain of nucleotides

12.3 Protein Synthesis (Translation). Watch these animations and try to explain what is going on. ◦Animation 1Animation 1 ◦Animation 2Animation 2.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Section 20.2 Gene Expression

Ribosomes and Protein Synthesis

Protein Synthesis Translation.

PROTEIN SYNTHESIS CHAPTER 10 section 4

(3) Gene Expression Gene Expression (A) What is Gene Expression?

Gene Expression Continued

Proteins and Translation

Protein Synthesis.

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

Transcription and Translation

How DNA and RNA make Proteins.

Protein Synthesis: Translation

Daily Warm-Up Dec. 12th Transcribe this DNA segment

Amino Acid Activation And Translation.

RNA and Protein Synthesis

Ch. 12 Protein Synthesis.

Nucleic Acids: RNA Ribonucleic Acid: RNA

Transcription Steps to Transcribe DNA:

Protein Synthesis Translation

RNA - TRANSLATION.

Unit 7: Molecular Genetics

GENE EXPRESSION / PROTEIN SYNTHESIS

Translation: Protein Synthesis

Protein Synthesis.

Presentation transcript:

DNA / RNA

tRNA rRNA mRNA 5’ 3’ Types of RNA

Transcription: transfer of information from DNA to RNA in the nucleus  In the process of transcription DNA is used to make a complimentary strand of RNA  The WHOLE strand of DNA doesn’t get turned into RNA at once  Instead, as needed, small sections of DNA are transcribed into RNA Sections are called???  GENES

Transcription: If a gene is transcribed into mRNA it is being “expressed” Having the gene in your DNA is not enough It MUST be turned into RNA to do anything

Genetic Code: Every three bases of the mRNA is called a Codon Each codon represents an Amino Acid The first codon of a gene is ALWAYS AUG 5’ 3’ AU GA GG

Genetic Code: There are 64 possible three base combinations of AUGC 1 is the start codon AUG (methionine) 3 are stop codons and tell the cell when the protein is done: UAA, UAG, UGA The other 60 represent the other 19 amino acids.

Genetic Code: AUG tells the cell to bring in the amino acid Methionine AGG tells the cell to bring in a different amino acid, arginine 5’ 3’ AU GA GG

Translation: The mRNA formed in transcription is taken to the ribosome where it serves as the directions to form a sequence of amino acids which form proteins. - Ribosome is made out of protein and rRNA

Translation: Step 1: mRNA lines up in the ribosome 5’ 3’ AU GA GG

Translation: Step 2: Enter tRNA - tRNA is a twisted up piece of RNA with an amino acid attached to one end

V. Translation: Step 2: Enter tRNA - Only bases we are interested in are the 3 at the bottom - These are called the Anti-codon

Translation: Step 2: Enter tRNA - There is a tRNA with a unique anti- codon for each Amino Acid - The anti-codon binds to its complimentary codon in the mRNA

Translation: 5’ 3’ Step 2: tRNA with anti-codon complimentary to AUG enters Ribosome with the first amino acid AA 1

Translation: AA 2 5’ 3’ Step 3: Next tRNA enters and chain of amino acids begins AA 1

Translation: 5’ 3’ Step 3: Next tRNA enters and chain of amino acids begins AA 1 AA 2

Translation: 5’ 3’ Step 3: Next tRNA enters and chain of amino acids begins AA 1 AA 2

Translation: 5’ 3’ Step 4: A covalent Bond forms between AA1 and AA2 AA 1 AA 2

Translation: 5’ 3’ Step 5: Ribosome shifts, releases tRNA 1, opens up new codon on the mRNA AA 1 AA 2 AA 3

Translation: 5’ 3’ Step 5: Ribosome shifts, releases tRNA 1, opens up new codon on the mRNA AA 1 AA 2 AA 3

Translation: 5’ 3’ Step 5: Ribosome shifts, releases tRNA 1, opens up new codon on the mRNA AA 1 AA 2 AA 3

Translation: 5’ 3’ Step 5: Ribosome shifts, releases tRNA 1, opens up new codon on the mRNA AA 1 AA 2 AA 3

Translation: 5’ 3’ Step 6: Process continues until open codon is one of the 3 STOPS. AA 1 AA 2 AA 3 STOP

VI. Translation: 5’ 3’ Step 7: Completed Protein is released. AA 1 AA 2 AA 3 STOP

Transcription (happens in the nucleus) Translation (happens at the ribosome)

Translate the mRNA an amino Acid sequence.

Useful links - Lew - Port's Biology Place