Sage: A Free, Open-Source Mathematics Software Program By NPZR.

Slides:



Advertisements
Similar presentations
 Dokeos  open source elearning
Advertisements

Technology in Mathematics Education at ECC Overview & Evaluation hosted by Paul M. Yun.
Sage: an open-source computer algebra system (CAS) William Stein joined the UW Mathematics Department in 2006 as an associate professor.
Department of Mathematics and Computer Science
RCAC Research Computing Presents: DiaGird Overview Tuesday, September 24, 2013.
1 CALCULUS Even more graphing problems
COMP1261 Advanced Algorithms n 15 credits, Term 1 (Wednesday 9-12) n Pre-requisites: Calculus and Mathematical Methods, Numerical Mathematics and Computer.
A. Frank - P. Weisberg Operating Systems Structure of Operating Systems.
Oct 30, 2001 Richard Fateman1 Do Math Making Computers Do Math Prof. Richard Fateman Fall, 2001 University of California, Berkeley.
Modeling and Simulation of linear dynamical systems using open tools Zoltán Magyar Tomáš Starý Ladislav Szolik Ľudovít Vörös Katar ína Žáková.
Teaching Linear Algebra: Technology and Resources Leslie Hogben Iowa State University, USA 3rd University Mathematics Courses Forum Chengdu, China November.
Jennifer Paoletti. Office Live Workspace Basics provides a user with its own domain name, and the ability to create their own website. It also provides.
IIS vs. Apache. Five advantages of IIS 1. It is has a GUI interface, which makes the installation a bit easier. 2. It "plays" well with other Microsoft.
Access The L Line The Express Line to Learning 2007 L Line L © Wiley Publishing All Rights Reserved.
Open Office Writer Computer Training Programme Speaker Kumardeep Chaudhary 17th September 2014 (Wednesday)
Nikto LUCA ALEXANDRA ADELA. Nikto  Web server assessment tool  Written by Chris Solo and David Lodge  Released on December 27, 2001  Stable release:
Chapter 3  Manage the computer’s resources ◦ CPU ◦ Memory ◦ Disk drives ◦ Printers  Establish a user interface  Execute and provide services for applications.
Introduction of Some Useful Free Software Cheng-Han Du.
Thinking Mathematically Algebra: Graphs, Functions and Linear Systems 7.3 Systems of Linear Equations In Two Variables.
1. Copyright © 2012 Pearson Education, Inc. Publishing as Prentice Hall 2 Technology in Action Technology in Focus: Computing Alternatives.
Linux Operations and Administration
Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.
 2008 Pearson Education, Inc. All rights reserved Introduction to Computers, the Internet and World Wide Web.
OpenAlea An OpenSource platform for plant modeling C. Pradal, S. Dufour-Kowalski, F. Boudon, C. Fournier, C. Godin.
1 8/29/05CS360 Windows Programming Professor Shereen Khoja.
WEB-ENHANCED INFORMATION MANAGEMENT (COMS E6125) SPRING 2008 (CVN) NAVID AZIMI (NA2258) Web Platforms, or: How I Learned To Stop Worrying And Love Facebook.
Patient Location via Received Signal Strength (RSS) Analysis Dan Albano, Chris Comeau, Jeramie Ianelli, Sean Palastro Project Advisor Taib Znati Tuesday.
Pure and Applied Number Theory School Cheolmin Park NIMS.
Structure of Study Programmes Bachelor of Computer Science Bachelor of Information Technology Master of Computer Science Master of Information Technology.
Computer Software Chapter 4 McGraw-Hill/IrwinCopyright © 2011 by The McGraw-Hill Companies, Inc. All rights reserved.
Teaching with technology Ruth Adkins th Grade.
MathCore Engineering AB Experts in Modeling & Simulation WTC.
ECE 103 Engineering Programming Chapter 40 C Graphing Libraries Herbert G. Mayer, PSU CS Status 6/4/2014 Initial content copied verbatim from ECE 103 material.
Ch 1. A Python Q&A Session Spring Why do people use Python? Software quality Developer productivity Program portability Support libraries Component.
GeoGebra Dynamic Geometry, Algebra and Calculus Markus Hohenwarter,
MAT 1221 Survey of Calculus Maple
Web Controlled of Robot Georgi Chakarov Ivelin Stoyanov.
Sage Prof. William Stein August Sun Confidential: Internal Only 2 What is Sage? Goal: Create a viable free open source alternative to Magma, Maple,
Copyright © 2008 Siemens Corporate Research – All rights reserved1/12 eXtensible Imaging Platform (Xip) Sylvain Jaume – Sep 2008 Siemens Corporate Research.
Computing Orientation Mathematical Sciences August 21, 2008 Jack Schmidt, System Administrator.
1 OpenSolaris A Seminar Presentation on Submitted to:- Dept.of CSE Poornima College of Engg., Jaipur Submitted by:- Ajay Kr. Jain IV th Yr.(CSE)
A. Frank - P. Weisberg Operating Systems Structure of Operating Systems.
Visualization in Problem Solving Environments Amit Goel Department of Computer Science Virginia Tech June 14, 1999.
1 Beginning & Intermediate Algebra – Math 103 Math, Statistics & Physics.
Java Example Presentation of a Language. Background Conception: Java began as a language for embedded processors in consumer electronics, such as VCR,
BIF713 Operating System Concepts MS Windows. Agenda 1. What is an Operating System (definition)? 2. Types of Operating Systems 3. Basic Operations: –
GeoGebra Please INSTALL GeoGebra WITH INTERNET Go to Click WebStart third item in the left menu Click button WebStart.
CMSC 491/691 A Web of Data Administrivia Spring
E-learning Some examples of new ICT tools in action - Alan Coop, July 2011.
1 Expanding the Application Base of the SAGE Collaboration Platform Javier Delgado.
Operating Systems By-Anoushka Puri. What is an Operating System An operating system is an interface between the user and the computer hardware. It is.
Microsoft Mathematics 4.0 October 8 th, 1 P.M. Andy Imm.
Course Overview: Linear Algebra
New Curricula Proposal at FSMN by Miroslav Ćirić & Predrag Krtolica.
Notes Over 3.1 Solving a System Graphically Graph the linear system and estimate the solution. Then check the solution algebraically.
Best 5 Mobile App Development Tools for Developer's to think beyond the Limitation.
Welcome to Open Source Technology An Overview of Software By Afroz Hippargi, CIT, YASHADA, Pune.
Creating your course on MOODLE Learning Management System.
Bucharest, 23 February 2005 CHM PTK technologies Adriana Baciu Finsiel Romania.
WebMathematics Interactive the symbolic calculator for the today's student Zoltán Kovács Dept. of Analysis University of Szeged, Hungary 1.
Unifying Mathematical Systems with Georg Muntingh Center of Mathematics for Applications, Oslo October 1 st 2007.
Linux - computer operating system
Operating System Assignment Help Sage-Fox.com Free PowerPoint Templates.
Operating System Assignment Help Sage-Fox.com Free PowerPoint Templates.
CSC391/691 Intro to OpenCV Dr. Rongzhong Li Fall 2016
Operating System Concepts
University of Wisconsin – Stout
Introduction to R.
AGPL it is a free software License or a variation of the GPL License
FEATURES OF PYTHON.
Presentation transcript:

Sage: A Free, Open-Source Mathematics Software Program By NPZR

Concept Commercial mathematics software programs are often very costly (one semester of Mathematica is $45)‏ Being closed-source makes extending functionality difficult Various free, open-source math software libraries already existed; why not combine them?

Beginnings of Started as a collaboration between math professor William Stein at Harvard and other professors, graduate students in 2004 An “open source alternative to Magma, Maple, Mathematica, and MATLAB” A collection of free, open-source libraries and packages along with many, many lines of Python- and Cython-based Sage code First official release in 2006

Designed for use with algebra, calculus, elementary to very advanced number theory, cryptography, commutative algebra, group theory, combinatorics, graph theory, exact linear algebra, and many others Graphical front-end to local (or remote) Sage web server via AJAX and jsMath Object-oriented, user-extensible Python environment Interface to third-party software such as Mathematica, Maple, and Magma Supports Linux and OS X natively; Windows through VMWare image (with native port in the works)‏ Features

Sage Example