Modeling and Conceptualize A Secure Ad hoc Routing Protocol in Wireless Networks Using DNA Cryptography E.SURESH BABU M.TECH(Phd) Dept of IT Mentee Laki.

Slides:



Advertisements
Similar presentations
INTRODUCTION TO DNA By the end of this lecture you will know:
Advertisements

TAODV: A Trusted AODV Routing Protocol for MANET Li Xiaoqi, GiGi March 22, 2004.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
TAODV: A Trust Model Based Routing Protocol for Secure Ad Hoc Networks Xiaoqi Li, Michael R. Lyu, and Jiangchuan Liu IEEE Aerospace Conference March 2004.
Component-Based Routing for Mobile Ad Hoc Networks Chunyue Liu, Tarek Saadawi & Myung Lee CUNY, City College.
C HAPTER 11: DNA AND G ENES 11-1 – DNA: The Molecule of Heredity.
Essential Idea The structure of DNA allows efficient storage of genetic information.
Itrat Rasool Quadri ST ID COE-543 Wireless and Mobile Networks
The structure of DNA.
DNA Structure Review. Questions 1.Name the term used to describe the shape of the DNA molecule. 2.What does DNA stand for? 3.What 3 chemicals make up.
DNA Deoxyribonucleic Acid. DNA Structure What is DNA? The information that determines an organism’s traits. Stores and passes on genetic information.
Date DNA. ✤ DNA stands for deoxyribonucleic acid ✤ DNA carries all the genetic information of living organisms.
DNA Structure.
DNA: the blueprint of life. Where do you get your DNA? DNA is passed from parent to offspring. Where do we find DNA? DNA is in the nucleus of every cell.
From DNA to Protein. Knowledge of Nucleic Acid Chemistry Is Essential to the Understanding of DNA Structure.
Regents Biology Nucleic Acids Information storage.
WIRELESS AD-HOC NETWORKS Dr. Razi Iqbal Lecture 6.
Implementation of Collection Tree Protocol in QualNet
What is DNA Computing? Shin, Soo-Yong Artificial Intelligence Lab.
Security in Mobile Ad Hoc Networks: Challenges and Solutions (IEEE Wireless Communications 2004) Hao Yang, et al. October 10 th, 2006 Jinkyu Lee.
(C) 2002, SNU Biointelligence Lab, A Computer Scientist’s Guide to Molecular Biology Biointelligence Lab. Interdisciplinary Program.
Nucleic Acid Nucleic Acids Examples: – RNA (ribonucleic acid) single helix – DNA (deoxyribonucleic acid) double helix Structure: – monomers = nucleotides.
NUCLEIC ACIDS. The four major classes of macromolecules are: Carbohydrates Proteins Lipids Nucleic acids.
Intro DSR AODV OLSR TRBPF Comp Concl 4/12/03 Jon KolstadAndreas Lundin CS Ad-Hoc Routing in Wireless Mobile Networks DSR AODV OLSR TBRPF.
8.2 Structure of DNA TEKS 3F, 6A, 6B The student is expected to: 3F research and describe the history of biology and contributions of scientists; 6A identify.
Ad Hoc On-Demand Distance Vector Routing (AODV) ietf
Information molecules
Deoxyribonucleic Acid Structure Function Replication Recombinant DNA DNA versus RNA.
DNA Introduction. What is DNA? Genetic information of life Type of Nucleic Acid Double Stranded.
8.2 Structure of DNA KEY CONCEPT DNA structure is the same in all organisms. Deoxyribonucleic Acid.
8.2 Structure of DNA KEY CONCEPT DNA structure is the same in all organisms.
DNA (Deoxyribonucleic Acid). What is DNA? DNA is an encoded molecule that determines traits by giving instructions to make proteins.
California Standard What It Means 7.1.a Students know cells function similarly in all living organisms. Cells perform the same actions in all living things.
DNA HISTORY, STRUCTURE, & REPLICATION. WHAT IS DNA? Deoxyribose Nucleic Acid Polymer made out of sugars (deoxyribose), phosphates, and nitrogen bases.
Mobile Ad Hoc Networking By Shaena Price. What is it? Autonomous system of routers and hosts connected by wireless links Can work flawlessly in a standalone.
DNA. NUCLEOTIDES: Makes up DNA DNA is made of only 3 units: Sugar Phosphate Base.
미래의 계 산 화공생명공학과 01 김선호. Outline Quantum Computing DNA Computing Single Electron Transistor.
Presented by Edith Ngai MPhil Term 3 Presentation
DNA: The Molecule of Heredity
MOBILE AD-HOC NETWORKS
Mrs. Wharton’s Science Class
M.B.Ch.B, MSC, DCH (UK), MRCPCH
Nucleic Acids DNA and RNA.
Nucleic Acids Information storage
DNA The Secret Code.
Ad-hoc On-demand Distance Vector
Ad-hoc On-demand Distance Vector
DNA Replication & Protein Synthesis
Nucleic Acids.
Introduction to DNA February 9th, 2016.
DNA The Secret Code.
What is the structure and function of DNA?
DNA (Deoxyribonucleic Acid)
Nucleic Acids.
How does DNA “tell” our cells what to do?
The Function and Structure of DNA
DNA Notes.
Cell division and DNA replication
What is the structure and function of DNA?
DNA Notes.
Nucleic Acids.
Unit 1.2 Review.
The Structure of Deoxyribonucleic Acid
DNA Deoxyribonucleic acid What is it??? DNA is a biomolecule
DNA.
Structure and function of DNA
CHAPTER 4C….. Genes and DNA.
Learning Objectives Learn the Base Pairs of DNA
DNA: History and Structure.
DNA Deoxyribonucleic Acid
Presentation transcript:

Modeling and Conceptualize A Secure Ad hoc Routing Protocol in Wireless Networks Using DNA Cryptography E.SURESH BABU M.TECH(Phd) Dept of IT Mentee Laki Reddy Bali Reddy College of Engineering, Mylavaram Dr. G. Ram Murthy Mentor Dr.C.Nagaraju Professor &Head Mentee

2 Introduction  Recent Advances in Mobile Technology and Mobile Devices Mobile Computing has become an important part of our life. People are using wireless networks for their day-to-day work  The desire to be connected anytime, anywhere, anyhow has led to the development of wireless networks

Statement of the Problem  In this Proposed work, Focus has been put on the strategy to address the security issue A lot of emphasis has been given on the routing mechanism and Security Area has not been addressed adequately in Existing Research 3

Statement of the Problem  The Main Objective of the Proposed Work can be stated as – “ Modeling and Conceptualize a secure routing protocol for MANETs”.  In order to handle the above problem, the following outline is proposed Evaluation and Analysis of existing ad hoc routing protocols Design and development of the proposed routing protocol 4

Statement of the Problem  The New Protocol will be proposed after proper verification and validation through simulations 5

Protocol Classes 6 Ready to go Whole topology Updates changes Reactive On-demand Little maintenance Cell operations Proactive Overhead Costs Bandwidth Battery power Inflexible

Proposed Work  In our study the On-demand (Reactive) Protocols have a lower communication overhead because the roots are built only when required and there are no periodic updates required.  We consider a Routing Protocol, namely, Ad hoc On-Demand Distance Vector (AODV). The AODV is an on-demand routing protocol based on the concept of reactive routing 7

AODV  Improving the A d-hoc O n-demand D istance V ector  Charles E. Perkins, 1999 Reactive protocol Fast discovery Loop free On-demand 8

Security Mechanisms 9

 A pseudo DNA (Deoxyribo Nucleic Acid) based cryptographic algorithm is used in order to secure the MANETs.  The pseudo DNA cryptography is a concept inspired from the field of life science and has been extended to the field of MANETs to secure them. 10

Introduction Encoding data “as in nature 11 Recombination algorithm InputOutput Molecular AI: DNA Computing

ATGCTCGAAGCT

DNA Computing 13DNA (Deoxyribonucleic acid) Genetic Genetic information “memory” Nucleotides Nucleotides strung into polymer chains polymer chains (DNA Strands) Four classes of nucleotides: Adenine, Guanine, Cytosine, Thymine Adenine, Guanine, Cytosine, Thymine (A,C,G,T) DNA

DNA Computing The Structure of DNA 14 The double helix structure discovered by Watson and Crick

15 HPP... ATG ACG TGC CGA TAA GCA CGT Solution PCR (Polymerase Chain Reaction) ATGTGCTAACGAACG ACGCGAGCATAAATGTGCCGT TAAACG CGACGT TAAACGGCAACG... CGACGTAGCCGT... ACGCGAGCATAAATGTGCCGT ACGCGTAGCCGT ACGCGT... ACGGCATAAATGTGCACGCGT ACGCGAGCATAAATGCGATGCCGT ACGCGAGCATAAATGTGCCGT... ACGCGAGCATAAATGTGCCGT Decoding Ligation Encoding Gel Electrophoresis Affinity Column ACGCGAGCATAAATGTGCACGCGT ACGCGAGCATAAATGCGATGCACGCGT ACGCGAGCATAAATGTGCACGCGT ACGCGAGCATAAATGCGATGCACGCGT

The Central Dogma of molecular biology 16

Pseudo DNA cryptography 17

Security Mechanisms  In proposed work, one potential key application will be used known as DNA- based molecular cryptography systems. it provides a much more compact storage medium, and An extremely small amount of DNA suffices even for huge one-time pads. 18

Conclusion  Finally,the New Routing Protocol will be validated through various simulation scenarios, 19

Thank U 20