Introduction Sample Projects Resources Summary Future Plans Bioinformatics Support Information Session Karsten Hokamp TCD 3rd October, 2007.

Slides:

Advertisements

Similar presentations

Computing Infrastructure

Advertisements

Operating System.

ABSTRACT WormBase is a freely available information resource primarily for the nematode Caenorhabditis elegans but which progressively includes data from.

HCS806 “Methods in Horticulture and Crop Science” Introduction to methods in Bioinformatics for plant science. David Francis (Coordinator) Ian Holford.

The design, construction and use of software tools to generate, store, annotate, access and analyse data and information relating to Molecular Biology.

Introduction to bioknoppix: Linux for the life sciences Carlos M Rodríguez Rivera Humberto Ortiz Zuazaga.

Bioinformatics for biomedicine Summary and conclusions. Further analysis of a favorite gene Lecture 8, Per Kraulis

A Grid implementation of the sliding window algorithm for protein similarity searches facilitates whole proteome analysis on continuously updated databases.

Bioinformatics Needs for the post-genomic era Dr. Erik Bongcam-Rudloff The Linnaeus Centre for Bioinformatics.

Kate Milova MolGen retreat March 24, Microarray experiments: Database and Analysis Tools. Kate Milova cDNA Microarray Facility March 24, 2005.

ONCOMINE: A Bioinformatics Infrastructure for Cancer Genomics

Kate Milova MolGen retreat March 24, Microarray experiments. Database and Analysis Tools. Kate Milova cDNA Microarray Facility March 24, 2005.

UK -Tomato Chromosome Four Sarah Butcher Bioinformatics Support Service Centre For Bioinformatics Imperial College London

STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2015 Xiaole Shirley Liu Please Fill Out Student Sign In.

Protein and Function Databases

High Performance Computing (HPC) at Center for Information Communication and Technology in UTM.

Genome database & information system for Daphnia Don Gilbert, October 2002 Talk doc at

Sequence Analysis with Artemis & Artemis Comparison Tool (ACT) South East Asian Training Course on Bioinformatics Applied to Tropical Diseases (Sponsored.

BIF713 Operating Systems & Project Management Instructor: Murray Saul

Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.

ISG We build general capability Introduction to Olympus Shawn T. Brown, PhD ISG MISSION 2.0 Lead Director of Public Health Applications Pittsburgh Supercomputing.

EGAN: Exploratory Gene Association Networks by Jesse Paquette Biostatistics and Computational Biology Core Helen Diller Family Comprehensive Cancer Center.

Cluster Computing Applications for Bioinformatics Thurs., Aug. 9, 2007 Introduction to cluster computing Working with Linux operating systems Overview.

Computer Programming for Biologists Oct 30 th – Dec 11 th, 2014 Karsten Hokamp  Fill out.

AUTHORS: STIJN POLFLIET ET. AL. BY: ALI NIKRAVESH Studying Hardware and Software Trade-Offs for a Real-Life Web 2.0 Workload.

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

The Open Source Virtual Lab: a Case Study Authors: E. Damiani, F. Frati, D. Rebeccani, M. Anisetti, V. Bellandi and U. Raimondi University of Milan Department.

Adding GO GO Workshop 3-6 August GOanna results and GOanna2ga 2. gene association files 3. getting GO for your dataset 4. adding more GO (introduction)

EADGENE and SABRE Post-Analyses Workshop 12-14th November 2008, Lelystad, Netherlands 1 François Moreews SIGENAE, INRA, Rennes Cytoscape.

Predicting MicroRNA Genes and Target Site using Structural and Sequence Features: Machine Learning Approach Malik Yousef Institute of Applied Research,

UBio Training Courses Micro-RNA web tools Gonzalo

Introduction to Bioinformatics Biostatistics & Medical Informatics 576 Computer Sciences 576 Fall 2008 Colin Dewey Dept. of Biostatistics & Medical Informatics.

LHCb-Italy Farm Monitor Domenico Galli Bologna, June 13, 2001.

Bioinformatics Core Facility Guglielmo Roma January 2011.

Wellcome Trust Sanger Institute Informatics Systems Group Ensembl Compute Grid issues James Cuff Informatics Systems Group Wellcome Trust Sanger Institute.

Rob Allan Daresbury Laboratory NW-GRID Training Event 25 th January 2007 Introduction to NW-GRID R.J. Allan CCLRC Daresbury Laboratory.

Developed at the Broad Institute of MIT and Harvard Reich M, Liefeld T, Gould J, Lerner J, Tamayo P, and Mesirov JP. GenePattern 2.0. Nature Genetics 38.

AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.

Building WormBase database(s). SAB 2008 Wellcome Trust Sanger Insitute Cold Spring Harbor Laboratory California Institute of Technology ● RNAi ● Microarray.

EMBOSS over a Grid 1. 1st EELA Grid School December 4th of 2006 Eduardo MURRIETA LEON Romualdo ZAYAS-LAGUNAS Pierre-Alain BRANGER Jérôme VERLEYEN Roberto.

Copyright OpenHelix. No use or reproduction without express written consent1.

Modelling proteins and proteomes using Linux clusters Ram Samudrala University of Washington.

A collaborative tool for sequence annotation. Contact:

An approach to carry out research and teaching in Bioinformatics in remote areas Alok Bhattacharya Centre for Computational Biology & Bioinformatics JAWAHARLAL.

Weekly Report By: Devin Trejo Week of June 21, 2015-> June 28, 2015.

Tutorial 3 BLAST 1. BLAST tutorial How to use BLAST Score vs. E-value Exercise Cool story of the day: How Alzheimer is studied in yeast 2.

Computational Research in the Battelle Center for Mathmatical medicine.

Data Integration & Data Mining Tool Donald Dunbar BHF CoRE Bioinformatics Team Edinburgh Bioinformatics Meeting April 2013.

Bioinformatics Workshops 1 & 2 1. use of public database/search sites - range of data and access methods - interpretation of search results - understanding.

ISG We build general capability Introduction to Olympus Shawn T. Brown, PhD ISG MISSION 2.0 Lead Director of Public Health Applications Pittsburgh Supercomputing.

Copyright OpenHelix. No use or reproduction without express written consent1 1.

Accessing and visualizing genomics data

Cloud Computing project NSYSU Sec. 1 Demo. NSYSU EE IT_LAB2 Outline  Our system’s architecture  Flow chart of the hadoop’s job(web crawler) working.

CIP HPC CIP - HPC HPC = High Performance Computer It’s not a regular computer, it’s bigger, faster, more powerful, and more.

STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2016 Xiaole Shirley Liu.

Advanced Computing Facility Introduction

Compute and Storage For the Farm at Jlab

Welcome to Indiana University Clusters

ISPyB December 4th, 2013 From sample to data analysis: how to track every step of an experiment in the ISPyB database. Marjolaine Bodin, ESRF/EXP/Structural.

National Center for Genome Analysis Support

PABIO 590B Advanced Topics in Bioinformatics

Introduction to Local Area Networks

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Ensembl Genome Repository.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

TF candidate selection pipeline.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

Introduction Sample Projects Resources Summary Future Plans Bioinformatics Support Information Session Karsten Hokamp TCD 3rd October, 2007

Introduction:  background  job description Sample Projects Resources Summary Future Plans Introduction Background

Introduction:  background  job description Sample Projects Resources Summary Future Plans 1998: M.Sc. equiv. in Bioinformatics 2002: Ph.D. in Genetics Bielefeld University 2005: current position : Research Fellow, SFU, B.C., Canada Introduction Background

Introduction:  background  job description Sample Projects Resources Summary Future Plans Data Introduction Job Description BiochemistryGeneticsMicrobiologyPhysiology Bioinformatics Applications

Introduction Sample Projects Resources Summary Future Plans Sample Projects

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects The extracellular Leucine-Rich Repeat superfamily Dolan et al, BMC Genomics Sep 14;8(1):320 BLAST all vs all TribeMCL clustering selection for eLRR manual curation merging of isoforms final list IPI human, mouse MGC human, mouse Ensembl fly, human, mouse, worm non-redundant proteomes: fly, human, mouse, worm architecture hmmpfam with Pfam, SMART signal TMHMM, HMMTOP, TMPRED, SignalP general Ensembl, IPI, MGC (gene ID, location, …) Protein datasetsAnnotation Pipeline

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects Prediction of miRNA targets Loscher et al., Genome Biology (accepted for publication) experiments miRanda Sanger miRDB 4 microRNAs predicted targets retina-specific genes EST libraries

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects CASBAH: The CAspase Substrate dataBAse

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects CASBAH: The CAspase Substrate dataBAse Luthi and Martin (2007) Cell Death Differ 14,

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects speed up programs through parallelisation LDhat complete stopped after six weeks finished within two days single CPU vs TCHPC IITAC (up to 356 CPUs) LDhat complete LDhat complete LDhat complete LDhat complete LDhat complete LDhat complete LDhat complete LDhat complete LDhat complete

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects miscellaneous activities microarray data analysis (ArrayPipe, BioConductor)

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects miscellaneous activities microarray data analysis programming help (Perl, C, Java)

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects miscellaneous activities microarray data analysis programming help local installation of programs (clustalw, BLAST, hmmpfam)

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects miscellaneous activities microarray data analysis programming help local installation of programs advise on experimental design (microarray experiments)

Introduction Sample Project:  ext. LRRs  miRNA targets  The CASBAH  complete  misc Resources Summary Future Plans Sample Projects miscellaneous activities microarray data analysis programming help local installation of programs advise on experimental design help with grant applications

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources hardware local servers: bioinf.gen.tcd.ie gen gen.tcd.ie gen gen.tcd.ie gen gen.tcd.ie external HTTP and SSH access 2 x dual core G5 8 GB RAM 1 TB disk space 2 x 1 TB backup shared home directories gigabit connection

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources hardware hosted server: genserver.tchpc.tcd.ie 2 x dual core AMD Opteron 8 GB RAM 1.5 TB disk space linked via Infiniband to IITAC

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources online

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources bioinf.gen.tcd.ie links to locally installed programs PubCrawler: It goes to the library. You go to the pub

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources bioinf.gen.tcd.ie links to locally installed programs course material: Computer programming for Biologists Bioinformatics from the UNIX command line

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources bioinf.gen.tcd.ie links to locally installed programs course material mailing list

Introduction Sample Project: Resources  hardware  online Summary Future Plans Resources bioinf.gen.tcd.ie links to locally installed programs course material mailing list contact information

Introduction Sample Project: Resources Summary Future Plans Summary I need help analysing my gene expression data! Where can I store my data? I’d like to learn how to program! Which program can I use to do XXX? I need access to a powerful UNIX computer! How can I make this run faster? I can only load up 20 sequences on the web! What does this parameter do? I can’t get this program to run! I wonder how Bioinformatics can boost this study?

Introduction Sample Project: Resources Summary Future Plans  tutorial: interactive web graphics  survey  backups  downstream microarray data analyses (network visualisations, GO enrichment)

Introduction Sample Project: Resources Summary Future Plans End