[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 6:

Slides:



Advertisements
Similar presentations
Dogmatic View of Gene Expression DNAProteinRNA Post-transcriptional Control: Quantitative Control: Levels of mRNA not proportional to levels of mRNA synthesized.
Advertisements

Gene expression From Gene to Protein
Gene Expression Chapter Eleven. What is Gene Expression? When a gene is expressed – that gene’s protein product is made: 1.DNA is transcribed into RNA.
RNA and Protein Synthesis
Predicting RNA Structure and Function. Non coding DNA (98.5% human genome) Intergenic Repetitive elements Promoters Introns mRNA untranslated region (UTR)
Predicting RNA Structure and Function
. Class 1: Introduction. The Tree of Life Source: Alberts et al.
Zhi John Lu, Jason Gloor, and David H. Mathews University of Rochester Medical Center, Rochester, New York Improved RNA Secondary Structure Prediction.
Predicting RNA Structure and Function. Nobel prize 1989Nobel prize 2009 Ribozyme Ribosome RNA has many biological functions The function of the RNA molecule.
Predicting RNA Structure and Function. Following the human genome sequencing there is a high interest in RNA “Just when scientists thought they had deciphered.
[Bejerano Fall10/11] 1.
. Class 5: RNA Structure Prediction. RNA types u Messenger RNA (mRNA) l Encodes protein sequences u Transfer RNA (tRNA) l Adaptor between mRNA molecules.
CISC667, F05, Lec19, Liao1 CISC 467/667 Intro to Bioinformatics (Fall 2005) RNA secondary structure.
Predicting RNA Structure and Function
Chapter 15 Noncoding RNAs. You Must Know The role of noncoding RNAs in control of cellular functions.
Chapter 11 Gene Expression and Epigenetics
[Bejerano Aut07/08] 1 MW 11:00-12:15 in Redwood G19 Profs: Serafim Batzoglou, Gill Bejerano TA: Cory McLean.
Predicting RNA Structure and Function. Nobel prize 1989 Nobel prize 2009 Ribozyme Ribosome.
Gene Expression and Cell Differentiation
CS273A Lecture 5: Genes Enrichment, Gene Regulation I
[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 8:
[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.
RNA-Seq and RNA Structure Prediction
Central Dogma & PCR B Wang Yu-Hsin.
How Genes Work. Transcription The information contained in DNA is stored in blocks called genes  the genes code for proteins  the proteins determine.
Essentials of the Living World Second Edition George B. Johnson Jonathan B. Losos Chapter 13 How Genes Work Copyright © The McGraw-Hill Companies, Inc.
Gene Expression and Cell Differentiation CSCOPE Unit: 08 Lesson: 01.
Introduction to RNA Bioinformatics Craig L. Zirbel October 5, 2010 Based on a talk originally given by Anton Petrov.
RNA informatics Unit 12 BIOL221T: Advanced Bioinformatics for Biotechnology Irene Gabashvili, PhD.
Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.
The Search for Small Regulatory RNA Central Dogma: DNA to RNA to Protein Replication Processing / Translocation hnRNA rRNAtRNA mRNA.
Control of Gene Expression Eukaryotes. Eukaryotic Gene Expression Some genes are expressed in all cells all the time. These so-called housekeeping genes.
Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.
From Structure to Function. Given a protein structure can we predict the function of a protein when we do not have a known homolog in the database ?
[BejeranoFall13/14] 1 MW 12:50-2:05pm in Beckman B302 Profs: Serafim Batzoglou & Gill Bejerano TAs: Harendra Guturu & Panos.
RNA Secondary Structure Prediction. 16s rRNA RNA Secondary Structure Hairpin loop Junction (Multiloop)Bulge Single- Stranded Interior Loop Stem Image–
1 TRANSCRIPTION AND TRANSLATION. 2 Central Dogma of Gene Expression.
How Genes Work Ch. 12.
Genetics AP Biology. The Discovery of DNA Structure Rosalind Franklin: x-ray diffraction photographs of DNA Rosalind Franklin: x-ray diffraction photographs.
12.3 DNA, RNA, and Protein Objective: 6(C) Explain the purpose and process of transcription and translation using models of DNA and RNA.
Gene expression. The information encoded in a gene is converted into a protein  The genetic information is made available to the cell Phases of gene.
Basics of RNA structure. RNA functions Storage/transfer of genetic information Genomes many viruses have RNA genomes single-stranded (ssRNA) e.g., retroviruses.
CS5263 Bioinformatics RNA Secondary Structure Prediction.
Progress toward Predicting Viral RNA Structure from Sequence: How Parallel Computing can Help Solve the RNA Folding Problem Susan J. Schroeder University.
Control of Gene Expression Chapter Proteins interacting w/ DNA turn Prokaryotic genes on or off in response to environmental changes  Gene Regulation:
Questions?. Novel ncRNAs are abundant: Ex: miRNAs miRNAs were the second major story in 2001 (after the genome). Subsequently, many other non-coding genes.
[BejeranoFall15/16] 1 MW 1:30-2:50pm in Clark S361* (behind Peet’s) Profs: Serafim Batzoglou & Gill Bejerano CAs: Karthik Jagadeesh.
RNA Structure Prediction RNA Structure Basics The RNA ‘Rules’ Programs and Predictions BIO520 BioinformaticsJim Lund Assigned reading: Ch. 6 from Bioinformatics:
Motif Search and RNA Structure Prediction Lesson 9.
CS173 Lecture 9: Transcriptional regulation III
GENOME: an organism’s complete set of genetic material In humans, ~3 billion base pairs CHROMOSOME: Part of the genome; structure that holds tightly wound.
IB Saccharomyces cerevisiae - Jan Major model system for molecular genetics. For example, one can clone the gene encoding a protein if you.
Unit-II Synthetic Biology: Protein Synthesis Synthetic Biology is - A) the design and construction of new biological parts, devices, and systems, and B)
Rapid ab initio RNA Folding Including Pseudoknots via Graph Tree Decomposition Jizhen Zhao, Liming Cai Russell Malmberg Computer Science Plant Biology.
Unit 1: DNA and the Genome Structure and function of RNA.
Gene structure and function
RNAs. RNA Basics transfer RNA (tRNA) transfer RNA (tRNA) messenger RNA (mRNA) messenger RNA (mRNA) ribosomal RNA (rRNA) ribosomal RNA (rRNA) small interfering.
Biochemistry Free For All
Halfway Feedback (yours)
CS273A Lecture 3: Non Coding Genes MW 12:50-2:05pm in Beckman B100
Protein Synthesis.
From Gene to Protein Chapter 2 and 7 of IB Bio book.
Predicting RNA Structure and Function
RNA Secondary Structure Prediction
RNA Secondary Structure Prediction
MicroRNAs: regulators of gene expression and cell differentiation
Profs: Serafim Batzoglou, Gill Bejerano TAs: Cory McLean, Aaron Wenger
mRNA Degradation and Translation Control
Noncoding RNA roles in Gene Expression
LAST UNIT! Energetics.
Presentation transcript:

[BejeranoWinter12/13] 1 MW 11:00-12:15 in Beckman B302 Prof: Gill Bejerano TAs: Jim Notwell & Harendra Guturu CS173 Lecture 6: NON protein coding genes

[BejeranoWinter12/13] 2 Announcements HW1 due in one week.

[BejeranoWinter12/13] 3 TTATATTGAATTTTCAAAAATTCTTACTTTTTTTTTGGATGGACGCAAAGAAGTTTAATAATCATATTACATGGCATTACCACCATATA CATATCCATATCTAATCTTACTTATATGTTGTGGAAATGTAAAGAGCCCCATTATCTTAGCCTAAAAAAACCTTCTCTTTGGAACTTTC AGTAATACGCTTAACTGCTCATTGCTATATTGAAGTACGGATTAGAAGCCGCCGAGCGGGCGACAGCCCTCCGACGGAAGACTCTCCTC CGTGCGTCCTCGTCTTCACCGGTCGCGTTCCTGAAACGCAGATGTGCCTCGCGCCGCACTGCTCCGAACAATAAAGATTCTACAATACT AGCTTTTATGGTTATGAAGAGGAAAAATTGGCAGTAACCTGGCCCCACAAACCTTCAAATTAACGAATCAAATTAACAACCATAGGATG ATAATGCGATTAGTTTTTTAGCCTTATTTCTGGGGTAATTAATCAGCGAAGCGATGATTTTTGATCTATTAACAGATATATAAATGGAA AAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAAT TGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACCTGAGTTCAA TTCTAGCGCAAAGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGG ATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGAT TTTGATATGCTTTGCGCCGTCAAAGTTTTGAACGATGAGATTTCAAGTCTTAAAGCTATATCAGAGGGCTAAGCATGTGTATTCTGAAT CTTTAAGAGTCTTGAAGGCTGTGAAATTAATGACTACAGCGAGCTTTACTGCCGACGAAGACTTTTTCAAGCAATTTGGTGCCTTGATG AACGAGTCTCAAGCTTCTTGCGATAAACTTTACGAATGTTCTTGTCCAGAGATTGACAAAATTTGTTCCATTGCTTTGTCAAATGGATC ATATGGTTCCCGTTTGACCGGAGCTGGCTGGGGTGGTTGTACTGTTCACTTGGTTCCAGGGGGCCCAAATGGCAACATAGAAAAGGTAA AAGAAGCCCTTGCCAATGAGTTCTACAAGGTCAAGTACCCTAAGATCACTGATGCTGAGCTAGAAAATGCTATCATCGTCTCTAAACCA GCATTGGGCAGCTGTCTATATGAATTAGTCAAGTATACTTCTTTTTTTTACTTTGTTCAGAACAACTTCTCATTTTTTTCTACTCATAA CTTTAGCATCACAAAATACGCAATAATAACGAGTAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGA TAATGTTTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTT GGATACCTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTTGCGAAGTT CTTGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGT TTTCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATAC CTATTCTTGACATGATATGACTACCATTTTGTTATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCT TGGCAAGTTGCCAACTGACGAGATGCAGTTTCCTACGCATAATAAGAATAGGAGGGAATATCAAGCCAGACAATCTATCATTACATTTA AGCGGCTCTTCAAAAAGATTGAACTCTCGCCAACTTATGGAATCTTCCAATGAGACCTTTGCGCCAAATAATGTGGATTTGGAAAAAGA GTATAAGTCATCTCAGAGTAATATAACTACCGAAGTTTATGAGGCATCGAGCTTTGAAGAAAAAGTAAGCTCAGAAAAACCTCAATACA GCTCATTCTGGAAGAAAATCTATTATGAATATGTGGTCGTTGACAAATCAATCTTGGGTGTTTCTATTCTGGATTCATTTATGTACAAC CAGGACTTGAAGCCCGTCGAAAAAGAAAGGCGGGTTTGGTCCTGGTACAATTATTGTTACTTCTGGCTTGCTGAATGTTTCAATATCAA CACTTGGCAAATTGCAGCTACAGGTCTACAACTGGGTCTAAATTGGTGGCAGTGTTGGATAACAATTTGGATTGGGTACGGTTTCGTTG GTGCTTTTGTTGTTTTGGCCTCTAGAGTTGGATCTGCTTATCATTTGTCATTCCCTATATCATCTAGAGCATCATTCGGTATTTTCTTC TCTTTATGGCCCGTTATTAACAGAGTCGTCATGGCCATCGTTTGGTATAGTGTCCAAGCTTATATTGCGGCAACTCCCGTATCATTAAT GCTGAAATCTATCTTTGGAAAAGATTTACAATGATTGTACGTGGGGCAGTTGACGTCTTATCATATGTCAAAGTCATTTGCGAAGTTCT TGGCAAGTTGCCAACTGACGAGATGCAGTAACACTTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTT TCAATGTAAGAGATTTCGATTATCCACAAACTTTAAAACACAGGGACAAAATTCTTGATATGCTTTCAACCGCTGCGTTTTGGATACCT ATTCTTGACATGATATGACTACCATTTTGTTATTGTTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTT TCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGA GATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTA TCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTT CATACATGCTTCAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTT CAACTACTTAATAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAA TAAATGATTGTATGATAATGTTTTCAATGTAAGAGATTTCGATTATCCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGT ATGATAATGTTTTCAATGTAAGAGATTTCGATTATCTTATAGTTCATACATGCTTCAACTACTTAATAAATGATTGTATGATAATAAAG

[BejeranoWinter12/13] 4 “non coding” RNAs (ncRNA)

5 Central Dogma of Biology:

6 Active forms of “non coding” RNA reverse transcription long non-coding RNA microRNA rRNA, snRNA, snoRNA

7 What is ncRNA? Non-coding RNA (ncRNA) is an RNA that functions without being translated to a protein. Known roles for ncRNAs: –RNA catalyzes excision/ligation in introns. –RNA catalyzes the maturation of tRNA. –RNA catalyzes peptide bond formation. –RNA is a required subunit in telomerase. –RNA plays roles in immunity and development (RNAi). –RNA plays a role in dosage compensation. –RNA plays a role in carbon storage. –RNA is a major subunit in the SRP, which is important in protein trafficking. –RNA guides RNA modification. –RNA can do so many different functions, it is thought in the beginning there was an RNA World, where RNA was both the information carrier and active molecule.

[BejeranoWinter12/13] 8 “non coding” RNAs (ncRNA) Small structural RNAs (ssRNA)

9 AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC UCAGGGGAAACUUUGAGAUG GCCUUGCAAAGGGUAUGGUA AUAAGCUGACGGACAUGGUC CUAACCACGCAGCCAAGUCC UAAGUCAACAGAUCUUCUGU UGAUAUGGAUGCAGUUCA ssRNA Folds into Secondary and 3D Structures Cate, et al. (Cech & Doudna). (1996) Science 273:1678. Waring & Davies. (1984) Gene 28: 277. We would like to predict them from sequence.

For example, tRNA

tRNA Activity

ssRNA structure rules Canonical basepairs: –Watson-Crick basepairs: G – C A – U –Wobble basepair: G - U Stacks: continuous nested basepairs. (energetically favorable) Non-basepaired loops: –Hairpin loop –Bulge –Internal loop –Multiloop Pseudo-knots

Ab initio RNA structure prediction: lots of Dynamic Programming Objective: Maximizing the number of base pairs (Nussinov et al, 1978) simple model:  (i, j) = 1 if allowed fancier model: GC > AU > GU

Pseudoknots drastically increase computational complexity

[Bejerano Fall11/12] 15 Objective: Minimize Secondary Structure Free Energy at 37 O C: Mathews, Disney, Childs, Schroeder, Zuker, & Turner PNAS 101: Instead of  (i, j), measure and sum energies:

Zuker’s algorithm MFOLD: computing loop dependent energies

Bafna1 RNA structure Base-pairing defines a secondary structure. The base-pairing is usually non-crossing.

S  aSu S  cSg S  gSc S  uSa S  a S  c S  g S  u S  SS 1. A CFG S  aSu  acSgu  accSggu  accuSaggu  accuSSaggu  accugScSaggu  accuggSccSaggu  accuggaccSaggu  accuggacccSgaggu  accuggacccuSagaggu  accuggacccuuagaggu 2. A derivation of “accuggacccuuagaggu” 3. Corresponding structure Stochastic context-free grammar

Cool algorithmics. Unfortunately… – Random DNA (with high GC content) often folds into low-energy structures. – We will mention powerful newer methods later on.

ssRNA transcription ssRNAs like tRNAs are usually encoded by short “non coding” genes, that transcribe independently. Found in both the UCSC “known genes” track, and as a subtrack of the RepeatMasker track [BejeranoWinter12/13] 20

[BejeranoWinter12/13] 21 “non coding” RNAs (ncRNA) microRNAs (miRNA/miR)

[BejeranoWinter12/13] 22 MicroRNA (miR) mRNA ~70nt~22nt miR match to target mRNA is quite loose.  a single miR can regulate the expression of hundreds of genes.

[BejeranoWinter12/13] 23 MicroRNA Transcription mRNA

[BejeranoWinter12/13] 24 MicroRNA Transcription mRNA

[BejeranoWinter12/13] 25 MicroRNA (miR) mRNA ~70nt~22nt miR match to target mRNA is quite loose.  a single miR can regulate the expression of hundreds of genes. Computational challenges: Predict miRs. Predict miR targets.

[BejeranoWinter12/13] 26 MicroRNA Therapeutics mRNA ~70nt~22nt miR match to target mRNA is quite loose.  a single miR can regulate the expression of hundreds of genes. Idea: bolster/inhibit miR production to broadly modulate protein production Hope: “right” the good guys and/or “wrong” the bad guys Challenge: and not vice versa.

[BejeranoWinter12/13] 27 Other Non Coding Transcripts

lncRNAs (long non coding RNAs) [BejeranoWinter12/13] 28 Don’t seem to fold into clear structures (or only a sub-region does). Diverse roles only now starting to be understood.  Hard to detect or predict function computationally (currently)

[BejeranoWinter12/13] 29 lncRNAs come in many flavors

X chromosome inactivation in mammals X XX Y X Dosage compensation

Xist – X inactive-specific transcript Avner and Heard, Nat. Rev. Genetics (1):59-67

[BejeranoWinter12/13] 32 Transcripts, transcripts everywhere Human Genome Transcribed* (Tx) Tx from both strands* * True size of set unknown

Or are they? [BejeranoWinter12/13] 33

[BejeranoWinter12/13] 34 The million dollar question Human Genome Transcribed* (Tx) Tx from both strands* * True size of set unknown Leaky tx? Functional?

Coding and non-coding gene production [BejeranoWinter12/13] 35 The cell is constantly making new proteins and ncRNAs. These perform their function for a while, And are then degraded. Newly made coding and non coding gene products take their place. The picture within a cell is constantly “refreshing”. To change its behavior a cell can change the repertoire of genes and ncRNAs it makes.

Cell differentiation [BejeranoWinter12/13] 36 To change its behavior a cell can change the repertoire of genes and ncRNAs it makes. That is exactly what happens when cells differentiate during development from stem cells to their different final fates.

Human manipulation of cell fate [BejeranoWinter12/13] 37 To change its behavior a cell can change the repertoire of genes and ncRNAs it makes. We have learned (in a dish) to: 1 control differentiation 2 reverse differentiation 3 hop between different states

Cell replacement therapies [BejeranoWinter12/13] 38 We want to use this knowledge to provide a patient with healthy self cells of a needed type. We have learned (in a dish) to: 1 control differentiation 2 reverse differentiation 3 hop between different states (iPS = induced pluripotent stem cells)

How does this happen? [BejeranoWinter12/13] 39 Different cells in our body hold copies of (essentially) the same genome. Yet they express very different repertoires of proteins and non-coding RNAs. How do cells do it? A: like they do everything else: using their proteins & ncRNAs…

Gene Regulation [BejeranoWinter12/13] 40 Some proteins and non coding RNAs go “back” to bind DNA near genes, turning these genes on and off. Gene DNA Proteins To be continued…

Review Lecture 6 Central dogma recap –Gene s, proteins and non coding RNAs RNA world hypothesis Small structural RNAs –Sequence, structure, function –Structure prediction –Transcription mode MicroRNAs –Functions –Modes of transcription lncRNAs –Xist Genome wide (and context wide) transcription –How much? –To what goals? Gene transcription and cell identity –Cell differentiation –Human manipulation of cell fates Gene regulation control [BejeranoWinter12/13] 41

[BejeranoWinter12/13] 42 (On Mondays) ask students to stack the chairs without wheels at the back of the room at the end of class.